See Full Document Text
रजिस्ट्री स.ं डी.एल.- 33004/99 REGD. No. D. L.-33004/99
सी.जी.-डी.एल.-अ.-11062025-263724
CG-DxLx-xEG-I1D1H0x6x2x0 25-263724
xxxGIDExxx
असाधारण
EXTRAORDINARY
भाग II—खण्ड 3—उप-खण्ड (ii)
PART II—Section 3—Sub-section (ii)
प्राजधकार स ेप्रकाजित
PUBLISHED BY AUTHORITY
स.ं 2479] नई कदल्ली, मगं लिार, िनू 10, 2025/ज्य ष्े ठ 20, 1947
No. 2479] NEW DELHI, TUESDAY, JUNE 10, 2025/JYAISTHA 20, 1947
कृजि और ककसान कल्याण मत्रं ालय
(कृजि और ककसान कल्याण जिभाग)
आदेि
नई कदल्ली, 9 िून, 2025
का.आ. 2539(अ).— केन्द्रीय सरकार, आिश्यक िस्ट्तु अजधजनयम, 1955 (1955 का 10) की धारा 3 द्वारा प्रदत्त
िजियों का प्रयोग करते हुए, उिवरक (अकार्वजनक, कार्वजनक या जमजित) (जनयंत्रण) आदेि, 1985 का और संिोधन करने के
जलए जनम्नजलजखत आदिे र्नाती ह,ै अर्ावत:-
1.(1 ) इस आदेि का संजिप्त नाम उिवरक (अकार्वजनक, कार्वजनक या जमजित) (जनयंत्रण) पांचिा संिोधन आदेि, 2025 ह ै ।
(2) यह रािपत्र में प्रकािन की तारीख को प्रिृत्त होगा।
2. उिवरक (अकार्वजनक, कार्वजनक या जमजित) (जनयंत्रण) आदेि, 1985, (जिसे इसमें इसके पश्चात् उि आदेि कहा गया ह)ै ,
खंड 20 ग के, उपखंड (3) म,ें मद ख के स्ट्र्ान पर, जनम्नजलजखत मदें रखी िाएंगी, अर्ावत:् -
“ख. िैि-प्रभािकाररता परीक्षण:
1. कृजि िैि प्रभािकाररता परीक्षण राष्ट्रीय कृजि अनुसंधान तंत्र जिसमें भारतीय कृजि अनुसंधान पररिद, राज्य कृजि
जिश्वजिद्यालय भी िाजमल ह,ैं में संचाजलत ककया िाएगा।
2. िैि प्रभािकाररता परीक्षण एक ही फसल पर कम स े कम एक मौसम के तीन जिजभन्न खरु ाकों के रूप म ें तीन कृजि-
पाररजस्ट्र्जतकी अिास्ट्र्ानों पर संचाजलत ककय े िाएंगे।”
3. उि आदेि की अनुसूची VI में,-
3752 GI/2025 (1)2 THE GAZETTE OF INDIA : EXTRAORDINARY [PART II—SEC. 3(ii)]
(i) भाग घ के स्ट्र्ान पर जनम्नजलजखत भाग रखा िाएगा, अर्ावत:् -
“भाग-घ
परीक्षण की कायपव द्धजत
1. पीएच का अिधारण
अनुसूची-IV, भाग-घ म ें क्रम संख्या 1 के अनुसार ।
2. जिजिष्ट गरुु त्ि का अिधारण
अनुसूची-II, भाग-ख म ें क्रम संख्या 21 के अनुसार ।
3. अजधक घनत्ि का अिधारण
अनुसूची-IV, भाग-घ के क्रम संख्या 2 के अनुसार ।
4. ओगजव नक पदार् वऔर कार्जव नक कार्नव का अिधारण
अनुसूची-IV, भाग-घ के क्रम संख्या 5 के अनुसार ।
5. िल म ेंघलु निीलता का अिधारण
5.1 उपकरण
(क) एनाजलरिकल र्लै ेंस
(ख) रोिरी ईिपे ोरेिर या हॉि एअर ओिन या हॉि प्लेि
(ग) तापमान जनयंत्रण िाला चुंर्कीय जस्ट्िरर
(घ) जस्ट्र्र तापमान िाला िािर-र्ार्
(ङ) व्हािमैन ग्रडे 934-एएच आरिीय ू ग्लास माइक्रोफाइर्र कफल्िर
5.2 प्रकक्रया
(i) परीक्षण नमूने को पानी की जनजश्चत मात्रा में न्द्यूनतम से लेकर अजधकतम मात्रा क्रमिः अलग-अलग मात्रा
में ल ें(िैसे 100 जम.ली.)।
(ii) घोल की संतृजप्त को जििुअली जनधावररत करें तर्ा जलए गए िल की मात्रा को संतृप्त करने के जलए आिश्यक
मात्रा को ररकॉडव करें।
(iii) परीक्षण नमनू ेकी अजतररि मात्रा (ग्राम) (पानी को संतृप्त करन ेके जलए आिश्यक परीक्षण पदार् वकी मात्रा
का लगभग पांच गुना) को काचं के डािों से लग े तीन कांच के र्तवनों (कोजनकल फ्लास्ट्क)म ें से प्रत्येक म ें
तौलें।
(iv) प्रारंजभक परीक्षण म ें जलए गए पानी की मात्रा (िैस े 100 जम. ली.) ल ें और प्रत्येक कांच के र्तवन म ें डालें।
कांच के र्तवन को कसकर र्ंद करें और कफर एक र्तवन को 30 जडग्री सेजल्सयस पर िािर-र्ार् में या चुंर्कीय
जस्ट्िरर पर चौर्ीस घंिे तक जहलाएँ।
(v) अन्द्य दो र्तवनों को क्रमिः अड़तालीस घंिे और र्हत्तर घंिे के जलए 30° सेजल्सयस पर संतुजलत
(ईक्यूजलजिएि) करें।
(vi) चौर्ीस घंिे के र्ाद, ककसी एक र्तवन को र्ीच-र्ीच म ें जहलाते हुए 20 ± 0.5° सेजल्सयस पर चौर्ीस घंिे
के जलए संतुजलत करें।
(vii) चौर्ीस घंिे के संतलु न के र्ाद, िॉिमैन ग्रडे 934-एएच आरिीयू ग्लास माइक्रोफाइर्र कफल्िर या 0.45
माइक्रोन मेमिेन कफल्िर का उपयोग करके जनिावत के प्रभाि म ेंघोल को क़िल्िर करें।
(viii) जनस्ट्यंद (कफल्िरेि) को गोल तली िाले फ्लास्ट्क म ें ल ें तर्ा 60° सेजल्सयस पर िािर-र्ार् सेि करके रोिरी
ईिेपोरेिर का उपयोग करते हुए िुष्कता तक जनिावत में िाजष्पत करें। (रोिरी ईिेपोरेिर के जिकल्प के
रूप म ेंहॉि प्लेि या हॉि एअर ओिन का भी उपयोग ककया िा सकता है)।
(ix) िाष्पीकरण के र्ाद अििेिों को सािधानीपूिवक एकत्र करें (यकद आिश्यक हो तो अििेिों को कमरे के
तापमान पर सुखाएं) और एनाजलरिकल र्लै ेंस का उपयोग करके अििेिों का भार ररकॉड वकरें।
(x) इसके अजतररि, 30 जडग्री सेजल्सयस पर पहल ेसे ही अड़तालीस घंिे और र्हत्तर घंिे के जलए संतुजलत ककए
गए अन्द्य दो र्तवनों को 20 ± 0.5 जडग्री सेजल्सयस पर चौर्ीस घंिे के जलए कभी-कभी जहलाते हुए संतुजलत
करें। ऊपर र्ताए गए बर्ंद ुम ेंर्ताई गई प्रकक्रया के अनुसार अििेिों का भार ररकॉडव करें।[भाग II—खण्ड 3(ii)] भारत का रािपत्र : असाधारण 3
(xi) यकद कम स ेकम दो अंजतम र्तवनों में माप ेगए अििेिों के भार में 15% स ेअजधक का अंतर नहीं ह,ै तो इस े
संतोििनक माना िाता ह।ै यकद र्तवन 1, 2 और 3 के पररणाम र्ढ़ते भार की प्रिृजत्त कदखाते ह,ैं तो परू े
परीक्षण को लंर् ेसमय तक संतलु न का उपयोग करके दोहराया िाना चाजहए।
5.3 गणना
नीचे कदए गए सूत्र द्वारा िल घलु निीलता % डब्लल्य/ूडब्लल्यू की गणना करें:
प्राप्त अििेि का रव्यमान (ग्राम)
िल म ेंघलु निीलता % डब्लल्यू/डब्लल्य ू= जलए गए परीक्षण पदार् वका रव्यमान (ग्राम में) x 100
6. कुल घजु लत ठोस (िीडीएस) या कुल घलु निील ठोस (िीएसएस)का अिधारण
6.1 उपकरण
(क) रोिरी ईिेपोरेिर या हॉि प्लेि
(ख) एनाजलरिकल र्लै ेंस
(ग) िोरिेक्स जमिण
6.2 प्रकक्रया
(i) एक पूिव-भाररत 500 जम.ली. ग्लास र्ीकर (डब्लल्य1ू ) में 100 जम.ली. तरल नमनू ा लें।
(ii) रोिरी इिेपोरेिर का उपयोग करके 60 जडग्री सेजल्सयस के तापमान पर या हॉि प्लेि का उपयोग करके
103 जडग्री सेजल्सयस पर गमव करें।
(iii) जिलायक के पूण व िाष्पीकरण, िर् तक जस्ट्र्र भार प्राप्त न हो िाए, के र्ाद र्ीकर का भार (डब्लल्यू2)
ररकाडव करें।
6.3 गणना
िीडीएस अर्िा िीएसएस (ग्राम/100 जम.ली.) = डब्लल्य2ू - डब्लल्यू1
7. एजल्गजनक एजसड का जनधारव ण और मात्रा अिधारण
7.1 उपकरण
(क) एचपीएलसी- आरआईडी प्रणाली
(ख) एनाजलरिकल र्लै ेंस
(ग) 0.45 माइक्रोन जसररंि क़िल्िर
(घ) उच्च गजत सेंरीफ्यूि
(ङ) िोरिेक्स जमक्सर
7.2 रसायन और अजभकमकव की तयै ारी
(क) सोजडयम एजल्गनेि (सीएएस नं. 9005-38-3)
(ख) अल्रा प्योर िािर
(ग) मानक तैयारी (स्ट्िैंडड वजप्रपेरेिन)-
(i) अल्रा प्योर िािर म ें सोजडयम एजल्गनेि मानकों (5 पीपीएम स े 500जम.ग्रा./जम.ली.) की एक िृंखला तैयार
करें।
(ii) सोजडयम एजल्गनेि स्ट्िॉक मानक जिलयन: 10 जम.ली. िॉल्यूमरे रक फ्लास्ट्क म ें लगभग 10 जम.ग्रा. सोजडयम
एजल्गनेि तौलें और इसे 10 जम.ली. अल्राप्योर िािर से तन ु करें और यह 1000 जम.ग्रा./जम.ली. का स्ट्िॉक
जिलयन दते ा ह।ै
(iii) सोजडयम एजल्गनेि मध्यिती मानक जिलयन : 1.0 जम.ली. स्ट्िॉक मानक जिलयन को अल्राप्योर िािर के
सार् 10 जम.ली. तक तन ु करें और अच्छी तरह से जमलाएं। यह 100 जम.ग्रा./जम.ली. का मध्यिती मानक
जिलयन दते ा ह ै।4 THE GAZETTE OF INDIA : EXTRAORDINARY [PART II—SEC. 3(ii)]
(iv) 1.0 जम. ली. मध्यिती मानक जिलयन को अल्राप्योर पानी के सार् 10 जम. ली. तक तन ु करें। यह 10
जम.ग्रा./जम.ली. का मध्यिती मानक जिलयन देता ह ै।
नमूना सांरता के अनुसार जनम्न सारणी म ें िर्णवत रैजखकता बर्ंद ुतैयार करें।
सारणी
क्र. स.ं रैजखकता स्ट्िॉक घोल की उपयोग ककय ेिान ेिाल े उपयोग ककये िान े मानक सांरता
मानक सांरता स्ट्िॉक घोल की मात्रा िाले पानी की मात्रा (जम.ग्रा./जम.ली.)
(जम.ग्रा./जम.ली (जम.ली.) (जम.ली.)
.)
(i) मानक 1 10 0.50 0.50 5
(ii) मानक 2 100 0.25 0.75 25
(iii) मानक 3 100 0.50 0.50 50
(iv) मानक 4 100 1.00 0.00 100
(v) मानक 5 1000 0.20 0.80 200
(vi) मानक 6 1000 0.30 0.70 300
(vii) मानक 7 1000 0.40 0.60 400
(Viii) मानक 8 1000 0.50 0.50 500
(घ) नमनू ा तैयार करना
(i) नमूने तैयार करने स ेपहले परीक्षण ककए िान े िाल ेफॉमूवलेिन को िोरिेक्स जमक्सर म ेंडालें।
(ii) ठोस नमूनों के जलए, नमनू े को अल्रा प्योर िािर (1:20 डब्लल्यू/िी) के सार् िोरिेक्स ककया िाना चाजहए
तर्ा र्ारह घंिे के जलए कमरे के तापमान पर रखा िाना चाजहए, तत्पश्चात ठीक स े जहलान े के उपरान्द्त
सेंरीफ्यूि करना चाजहए।
(iii) जिश्लेिण फोमूवलेिन म ें एजल्गनेि के अपेजक्षत मात्रा को ध्यान म ें रखत े हुए संयोिन को तन ु करें (लगभग 50
से 100 गनु ा)।
(iv) नमूनों को इस तरह स े तैयार ककया िाना चाजहए कक िे एकल मानकों (एजल्गनेि) के मानक िक्र सांरता के
अंतगतव आए ँ और प्रत्येक नमून े को 0.45 माइक्रोन जसररंि क़िल्िर से क़िल्िर करें और इसे 2 जम.ली.
एचपीएलसी ग्लास सैंपल िीजियों में भरें।
7.3 प्रकक्रया
(i) एचपीएलसी- आरआईडी प्रणाली म ेंमानक जिलयन और तैयार नमून ेकी समान मात्रा (50 जम.ग्रा.) को अलग-
अलग इंिेक्ि करें।
(ii) क्रोमैिोग्राम ररकॉडव करें और मानक जिलयन के पीक प्रजतकक्रया को मापें।
(iii) एकल मानक के जलए पीक प्रजतकक्रया के संर्ंध में िांजछत यौजगक की मात्रा की गणना करें।
(iv) जिश्लेिण के जलए जनम्न सारणी म ें िर्णवत क्रोमैिोग्राकफक जस्ट्र्जतयों का उपयोग करें
सारणी
(i) कॉलम रेिेक्स आरएचएम मोनोसैकेराइड एच+ एलसी कॉलम
(300 जममी x 7.8 जममी)
(ii) कॉलम तापमान 65° सेजल्सयस
(iii) जडिेक्िर अपितवक सूचकांक जडिेक्िर (आरआईडी)
(iv) जडिेक्िर तापमान 50o सेजल्सयस
(v) पंप मोड इसोक्रेरिक
(vi) मोर्ाइल फेज़ 0.05% एजसरिक एजसड[भाग II—खण्ड 3(ii)] भारत का रािपत्र : असाधारण 5
(vii) इंिेक्िन की मात्रा 50 माइक्रो लीिर
(viii) जसग्नल अजधग्रहण सकारात्मक ध्रुिीयता मोड
(ix) प्रिाह दर 0.5 जम. ली./जमनि
7.4 गणना
एक्स-अक्ष के सार् सांरता और िाई-अक्ष के सार् क्षेत्रफल लेकर मानक जिलयनों के सार् मानक िक्र र्नाएँ। रैजखक
प्रजतगमन समीकरण का उपयोग करके मानक िक्र स ेपरीक्षण नमूनों में मौिूद एजल्गनेि की सांरता जनधावररत करें।
िाई = एमएक्स +र्ी
िहाँ,
िाई दसू रे डेिा सेि (पीक एररया) का मान ह ै
एक्स पहल े कदन सेि का मान ह ै(मानक की सांरता)
एम रेखा का स्ट्लोप ह ै
र्ी रेखा का िाई- इंिरसेप्ि ह ै
स्ट्लोप और अिरोधन की गणना जनम्न सत्रू का उपयोग करके की िा सकती है
एन∑ एक्सिाई - (∑ एक्स)(∑ िाई)
एम(स्ट्लोप)=
एन ∑ एक्स2 - (∑ एक्स)2
(∑िाई) ∑ एक्स 2 - ∑एक्स ∑एक्स िाई
र्ी (इंिरसेप्ि) =
एन∑एक्स2 - (∑एक्स)2
उदाहरण:
एक्स 2 4 6 8
िाई 3 7 5 10
जनम्नजलजखत सारणी र्नाए-ं
एक्स िाई एक्स2 एक्सिाई
2 3 4 6
4 7 16 28
6 5 36 30
8 10 64 80
∑एक्स = 20 ∑िाई= 25 ∑एक्स2 = 120 ∑एक्सिाई =
144
एम(स्ट्लोप) = 4(144) - 20 x 25/ 4(120) – 400 = 0.95
र्ी(इंिरसेप्ि)= 25 x 120 – 20 x 144/ 4(120)- 400 = 1.5
रैजखक प्रजतगमन के जलए समीकरण ह ै
िाई = एमएक्स+र्ी
िाई = 0.95एक्स + 1.56 THE GAZETTE OF INDIA : EXTRAORDINARY [PART II—SEC. 3(ii)]
7.5 सदं भ व
िाल्िरडे एस, हनाांडेज़-अपोलाज़ा एल, लुसेना िेिे 2022. एजल्गजनक एजसड, लैजमनाररन और मैजनिोल और समुरी
िैिाल अकव उिवरकों को जनधावररत करन े के जलए एक सरल जिश्लेिणात्मक जिजध। िनलव ऑ़ि क्रोमैिोग्रा़िी और
पृर्क्करण तकनीक िॉल्यूम 13 अंक 1 संख्या: 1000470.
8. कैरेिने न का अिधारण
8.1 उपकरण
(क) स्ट्पेक्रोफोिोमीिर
(ख) एनाजलरिकल र्लै ेंस
(ग) िोरिेक्स जमक्सर
8.2 रसायन और अजभकमकव की तयै ारी
(क) िोल्यूडीन ब्लल-ू ओ(सीएएस नं.: 92-31-9)
(ख) κ-कैरेिेनन मानक:(सीएएस न ं: 11114-20-8)
(ग) अल्रा प्योर िािर
(घ) अजभकमवक ए: 0.06 M िोल्यूडीन ब्लल-ू ओ(िीर्ीओ)घोल
(i) पानी म ें 2 mM की सांरता पर िीर्ीओ का स्ट्िॉक घोल तैयार करें (10 जम. ली. पानी म ें 6 जम. ग्रा)।
समान जमिण के जलए तीन स े पांच जमनि तक िोरिेक्स में रखें।
(ii) 2 mM िीर्ीओ स्ट्िॉक घोल के 0.6 जम.ली. को 19.4 जम.ली. पानी में जमलाकर इस े 0.06mM की
सांरता तक तनु करें।
(ङ) अजभकमवक र्ी: कैरेिेनन का स्ट्िॉक घोल (2 जम.ग्रा./जम.ली.)।
(i) मानक के रूप म ें -कैरेिेनन, (एक सल्फेिेड पॉलीसैकेराइड) का प्रयोग करें।
(ii) 10 जम.ली. िॉल्यूमेररक फ्लास्ट्क लें।
(iii) 20 जम.ग्रा. कैरेिेनान का ििन करें और इसे 10 जम.ली. मानक फ्लास्ट्क म ेंडालें।
(iv) मानक फ्लास्ट्क में 5-6 जम.ली. पानी डालें और कैरेिेनान को घोलें। समान जमिण के जलए तीन स े
पांच जमनि तक िोरिेक्स करें ।
(v) पानी का उपयोग करके अंजतम मात्रा 10 जम.ली. करें और सही जमिण के जलए अच्छी तरह
जमलाएं।
(च) अजभकमवक सी: कैरेिेनान का कायविील घोल (0.04 जम.ग्रा./जम.ली.)
i) 10 जम.ली. िॉल्यूमेररक फ्लास्ट्क ल ें
ii) मानक फ्लास्ट्क म ें200 माइक्रो लीिर अजभकमवक र्ी डाल ेंऔर पानी का उपयोग करके अंजतम मात्रा
10 जम.ली. करें और समरूपता के जलए अच्छी तरह जमलाएं।
रिप्पण : प्रत्येक अिधारण िुरू करने से पहले िोल्यडूीन ब्ललू ओ अजभकमवक और मानक घोल को तािा तैयार ककया
िाना चाजहए ।
(छ) मानक घोल की तयै ारी:
नीचे दी गई सारणी म ेंजनर्दवष्ट अनुसार कैरेिीनन कायविील जिलयन (अजभकमवक सी) और िल को जमलाकर
0(ररि, आसुत िल), 0.008, 0.016, 0.024, 0.032 और 0.040 जम.ग्रा./जम.ली. सांरता िाले कैरेिीनन
मानक जिलयनों (कांच की परखनजलयों में)की एक िृंखला तयै ार करें:
सारणी[भाग II—खण्ड 3(ii)] भारत का रािपत्र : असाधारण 7
क्र. स.ं अजभकमवक सी पानी (जम.ली.) कैरेिेनन सांरता (जम.ग्रा./जम.ली.)
(जम.ली.)
(i) 0 300 0
(ii) 60 240 0.008
(iii) 120 180 0.016
(iv) 240 60 0.032
(v) 300 0 0.04
(ि) नमनू ेकी तयै ारी
(क) तरल और जिस्ट्कॉस (िले ) उत्पाद के जलए:
(i) परीक्षण नमूने को पानी में उजचत रूप से तनु करें ताकक नमूने की अििोिण क्षमता मानक िक्र की सीमा
के भीतर रह े।
(ii) रंगीन नमूनों के मामले म,ें नमूने के िलीय घोल में सकक्रय चारकोल (1% िी/िी) जमलाएं और िोरिेक्स
जमक्सर का उपयोग करके 10 जमनि तक अच्छी तरह जहलाएं, उसके र्ाद छान लें।
(iii) κ-कैरेिेनन के आकलन के जलए जनस्ट्यंद का उपयोग करें
(ख) दानदे ार/ फ्लके उत्पाद के जलए:
(i) 90 जम. ली. पानी िाल े कोजनकल फ्लास्ट्क में 10 ग्राम परीक्षण नमूना दान/े फ्लेक लें।
(ii) कमरे के तापमान पर 45 जमनि तक रखें तर्ा घिकों को चुंर्कीय जस्ट्िरर पर एकरूपता तक जमलाएं।
(iii) 2 जम.ली. नमूना जनकाल ेंऔर 3000 आरपीएम पर 3 जमनि के जलए सेंरीफ्यूि करें।
(iv) इस प्रकार प्राप्त अजधप्लिी (सुपरनैिेंि) का उपयोग कैरेिने ान अर्िा सल्फेियुि िकवरा के जिश्लिे ण के जलए
ककया िाना चाजहए।
रिप्पण : लगभग 25 जम.ग्रा./जम.ली. सल्फेि यिु नमून ेमें कैरेिेनान अर्िा सल्फेि युि चीनी की सांरता का
अनुमान लगाने के जलए, नमूने को 103 गुना तन ुकरना होगा, ताकक तनु नमनूे की अनुमाजनत सांरता 0.025
जम.ग्रा./जम.ली. हो, िो मानक िक्र की सीमा के भीतर ह।ै
8.3 प्रकक्रया
(i) ऊपर तैयार मानक (या नमूना) घोल का 60 माइक्रो लीिर ल ेंऔर उसमें 240 माइक्रो लीिर िीर्ीओ घोल
(अजभकमवक ए) जमलाएं।
(ii) घोल को एकरूपता तक जमलाएं।
(iii) 630 एनएम पर अििोिण मापें।
(iv) एक्स अक्ष में सांरता और िाई अक्ष म ेंअििोिण का उपयोग करके मानक िक्र तैयार करें।
(v) मानक िक्र से परीक्षण नमून े में कैरेिेनान की सांरता की गणना करें
8.4 गणना
नीचे कदए गए सूत्र का उपयोग करके परीक्षण नमून े में कुल कैरेिेनन सामग्री की गणना करें:
कैरेिेनान की सांरता x डाइल्यिू न फेक्िर
% कैरेिने न = X 100
जलए गए नमनू े का ििन
8.5 सदं भ व
जज़ओल्कोव्स्ट्का डी, कनीिस्ट्क ए, लैमकीजिक्ज़ ि,े िाइचुक ए, 2017. मेजर्लीन ब्ललू और िोल्यूडीन ब्लल ू डाई के सार्
फोिोमेररक िाइरेिन के माध्यम से कैरेिेनान का जनधारव ण। कार्ोहाइड्रेि पॉजलमर 165: 1-6.
9. फ्यकू ोइडान का जनधारव ण और मात्रा अिधारण
9.1 उपकरण
(क) एचपीएलसी-आरआईडी प्रणाली8 THE GAZETTE OF INDIA : EXTRAORDINARY [PART II—SEC. 3(ii)]
(ख) एनाजलरिकल र्लै ेंस
(ग) 0.45 माइक्रोन जसररंि क़िल्िर
(घ) िोरिेक्स जमक्सर
9.2 रसायन और अजभकमकव तयै ारी
(क) फ्यूकोइडान (सीएएस संख्या.9072-19-9)
(ख) अल्रा प्योर िािर
(ग) मानक तैयारी:
(i) अल्रा प्योर िािर में फ्यूकोइडान मानकों (5 पीपीएम स े 500 जम.ग्रा./जम.ली.)की एक िृंखला तैयार करें।
(ii) फ्यूकोइडन स्ट्िॉक मानक जिलयन: 10 जम.ली. की िॉल्यूमेररक फ्लास्ट्क म ेंलगभग 10 जम.ग्रा. फ्यूकोइडन का
ििन करें और इसे 10 जम.ली. अल्राप्योर िािर से तनु करें। यह 1000 जम.ग्रा./जम.ली. का स्ट्िॉक जिलयन
देता ह।ै
(iii) फ्यूकोइडन मध्यिती मानक जिलयन : 1.0 जम.ली. स्ट्िॉक स्ट्िैंडडव को अल्राप्योर पानी के सार् 10 जम.ली.
तक तन ुकरें और अच्छी तरह स ेजमलाएं। यह 100 जम.ग्रा./जम.ली. का मध्यिती मानक जिलयन देता ह ै।
(iv) 1.0 जम. ली. मध्यिती मानक जिलयन को अल्राप्योर पानी के सार् 10 जम. ली. तक पतला करें। यह 10
जम.ग्रा./जम.ली. का मध्यिती मानक जिलयन देता ह ै।
(v) अनुसूची-VI के भाग-डी में पैराग्राफ 7.2 के उप पैराग्राफ (ग)(v) के अंतगवत जनर्दवष्ट रैजखकता बर्ंद ुतैयार करें।
(घ) नमनू ा तयै ार करना : अनुसूची-VI के भाग-डी में पैराग्राफ 7.2 के उप परै ाग्राफ (घ) के अंतगवत जनर्दवष्ट के समान।
9.3 प्रकक्रया और गणना
िैसा कक अनुसूची-VI के भाग-घ में पैराग्राफ 7.3 और 7.4 म ेंजनर्दवष्ट ह।ै
(रिप्पण: चूंकक सोजडयम एजल्गनेि फ्यूकोइडान के सार् हस्ट्तक्षपे करता ह,ै इसजलए नमूना तैयार करन ेसे पहल,े एजल्गनेि को
अिक्षेजपत करने के जलए 2% CaCl घोल जमलाएं। फ्यूकोइडान आकलन के जलए ििे घोल का उपयोग करें)।
2
10. मजै निोल का अिधारण
10.1 उपकरण
(क) एचपीएलसी- आरआईडी प्रणाली
(ख) जडिेक्िर: अपितवक सूचकांक जडिेक्िर
(ग) ऑनलाइन िैक्यूम जडगैसर
(घ) क्वािवरनेरी पंप
(ङ) उच्च गजत सेंरीफ्यूि
(च) एनाजलरिकल र्लै ेंस
(छ) िोरिेक्स जमक्सर
(ि) सोजनकेिर
(झ) 0.45 माइक्रोन जसररंि कफल्िर
10.2 रसायन और अजभकमकव की तयै ारी
(a) डी मैजनिोल (सीएएस संख्या 69-65-8)
(b) अल्रा प्योर िािर
(c) एजसरिक एजसड (0.05 %): एक लीिर एचपीएलसी ग्रेड पानी म ें0.5 जम. ली. एजसरिक एजसड मोर्ाइल फेि
कंिेनर म ेंल.ें
(d) मानकों की तैयारी:
(i) अल्रा प्योर िािर में मैजनिोल मानकों (5 पीपीएम स े 500 जम.ग्रा./जम.ली.) की एक िृंखला तैयार करें।
(ii) मैजनिोल स्ट्िॉक मानक समाधान: 10 जम.ली. िॉल्यूमेररक फ्लास्ट्क में लगभग 10 जम.ग्रा. मैजनिोल तौल ें
और इस े10 जम.ली. अल्राप्योर पानी से पतला करें। इसस े1000 जम.ग्रा./जम.ली. का स्ट्िॉक घोल र्नेगा।
(iii) मैजनिोल इंिरमीजडएि स्ट्िैंडडव सॉल्यूिन: 1.0 जम.ली. स्ट्िॉक स्ट्िैंडड व को अल्राप्योर पानी के सार् 10
जम.ली. तक पतला करें और अच्छी तरह से जमलाएं। यह 100 जम.ग्रा./जम.ली. का इंिरमीजडएि स्ट्िैंडड व
सॉल्यूिन दते ा ह ै।[भाग II—खण्ड 3(ii)] भारत का रािपत्र : असाधारण 9
(iv) 1.0 जम. ली. इंिरमीजडएि मानक घोल को अल्राप्योर पानी के सार् 10 जम. ली. तक पतला करें। यह
10 जम.ग्रा./जम.ली. का इंिरमीजडएि मानक घोल देता ह ै।
(v) अनुसूची-VI के भाग-घ म ें परै ाग्राफ 7.2 के उप पैराग्राफ (ग) (v) के अंतगवत जनर्दवष्ट रैजखकता बर्ंद ुतैयार
करें।
(ङ) नमनू ा तयै ार करना : अनुसचू ी-VI के भाग-घ म ेंपैराग्राफ 7.2 के उप परै ाग्राफ (घ) म ेंिर्णतव जनर्दवष्ट के समान।
10.3 प्रकक्रया और गणना
अनुसूची-VI के भाग-घ के उप पैराग्राफ 7.3 और 7.4 में िर्णतव जनर्दवष्ट के समान।
10.4 सदं भ व
िाल्िरडे एस, हनाांडेज़-अपोलाज़ा एल, लुसेना िेिे 2022. एजल्गजनक एजसड, लैजमनाररन और मैजनिोल और समुरी
िैिाल अकव उिवरकों को जनधावररत करन े के जलए एक सरल जिश्लेिणात्मक जिजध। िनलव ऑ़ि क्रोमैिोग्रा़िी और
पृर्क्करण तकनीक िॉल्यूम 13 अंक 1 संख्या: 1000470.
11. कुल पॉली-फेनोल्स का अिधारण
11.1 उपकरण
(क) स्ट्पेक्रोफोिोमीिर
(ख) एनाजलरिकल र्लै ेंस
(ग) उच्च गजत सेंरीफ्यूि
(घ) िोरिेक्स जमक्सर
(ङ) िािर-र्ार्
11.2 रसायन और अजभकमकव तयै ारी
(क) गैजलक एजसड (सीएएस नं 149-91-7) या फ़्लोरोग्लुसीनॉल (सीएएस नं 108-73-6 )
(ख) फोजलन-जसयोकाल्िेउ अजभकमवक (सीएएस संख्या 12111-13-6)
(ग) 80% िलीय मेर्नॉल: 80 जम.ली. मर्े नॉल म ें20 जम.ली. पानी जमलाएं।
(घ) 20% सोजडयम कार्ोनेि: 20 ग्राम सोजडयम कार्ोनेि का ििन करें और इसे 100 जम. ली. िॉल्यूमेररक फ्लास्ट्क
में डालें। इसमें 40 जम. ली. पानी डालें और घलु ने के जलए िोर से जहलाएं। पानी के सार् मात्रा को 100 जम. ली.
तक करें।
(ङ) नमूना तैयार करना
(i) रि और िले नमून े
िेल या तरल िैि उत्प्रेरक नमनू े को 80% मेर्नॉल के सार् जनकाला िाना चाजहए।
(1) 10 जम. ली. 80% िलीय मर्े नॉल (जनष्किणव अनपु ात- 1:10 िी/िी) के सार् 1 जम. ली. समुरी िैिाल
र्ायोजस्ट्िमुलेंि नमूने को रात भर अधं ेरे में 4° सेजल्सयस पर रख।ें
(2) जमिण को अच्छी तरह से िोरिेक्स करें और 4° सेजल्सयस पर पांच जमनि के जलए 12000 ×िी पर सेंरीफ्यूि
करें।
(3) सुपरनेिेंि को एकजत्रत करें और आग ेके जिश्लेिण के जलए इसका उपयोग करें।
(ii) ठोस नमूने (पाउडर, ग्रन्द्े यूल्स और फ्लेक)
(1) सही ढंग से तौला हुआ समरूप ठोस र्ायोजस्ट्िमुलेंि नमूना (0.3 ± 0.005 ग्राम) जनकाल,ें 15 जम.ली. 80%
िलीय मेर्नॉल के सार् अंधरे े म ें 4° सेजल्सयस पर रात भर रखें।
(2) जमिण को अच्छी तरह स े िोरिेक्स करें और 4°सेजल्सयस पर 5 जमनि के जलए 12000× िी पर सेंरीफ्यूि
करें।
(3) सुपरनेिेंि को एकजत्रत करें और आग ेके जिश्लेिण के जलए इसका उपयोग करें।
(च) गैजलक एजसड मानक जमिण:
(i) लगभग 100 जम.ग्रा. गैजलक एजसड का सही ििन ल ेंऔर इस े100 जमली लीिर िॉल्यूमेररक फ्लास्ट्क म ेंडालें।
लगभग 75 जमली लीिर पानी डालें और तर् तक अच्छी तरह जमलाएँ िर् तक कक ठोस पदार् वघलु न िाएँ।
(ii) पानी के सार् 1000 जमली लीिर मात्रा पूरी करें और अच्छी तरह जमलाएं।10 THE GAZETTE OF INDIA : EXTRAORDINARY [PART II—SEC. 3(ii)]
(iii) इसे "स्ट्िॉक मानक जिलयन" के रूप में लेर्ल करें। इस स्ट्िॉक मानक जिलयन (लगभग 1000 जम.ग्रा./लीिर
गैजलक एजसड) को 2-8 जडग्री सजे ल्सयस पर संग्रहीत करन े पर 1 महीने तक प्रयोग ककया िा सकता ह।ै
(iv) जनम्न िर्णवत सारणी के अनुसार स्ट्िॉक मानक जिलयन की िर्णतव मात्रा को िर्णवत आकार के िॉल्यूम फ्लास्ट्क
में जपपेि करके और पानी के सार् मात्रा तक पतला करके (लगभग 40-200 जम.ग्रा./लीिर गैजलक एजसड)
कैजलिेिन मानक जिलयन तैयार करें। प्रत्येक कैजलिेिन मानक जिलयन में गैजलक एजसड की अनुमाजनत सांरता
सारणी म ेंदिावई गई ह।ै
सारणी
क्रं. स.ं कैजलिेिन िॉल्यूम स्ट्िॉक स्ट्िैंडड व िॉल्यूम फ्लास्ट्क, गैजलक एजसड की
जमली लीिर अनुमाजनत सांरता,
मानक सॉल्यूिन, जमली लीिर
जम.ग्रा./लीिर
सॉल्यूिन
(i) 1 1 25 40
(ii) 2 2 25 80
(iii) 3 3 25 120
(iv) 4 4 25 160
(v) 5 5 25 200
11.3 प्रकक्रया :
(1) एक परखनली में 15 जमली लीिर आसतु िल में 1 जमली लीिर सुपरनेिेंि तर्ा 1 जमली लीिर फोजलन-जसओकाल्िेउ
अजभकमवक जमलाएं।
(2) परखनली की सामग्री को अच्छी तरह जमलाएं और पांच जमनि तक रखें।
(3) पांच जमनि के इन्द्क्यूर्ेिन के र्ाद, 3 जम.ली. 20% सोजडयम कार्ोनेि डालें और उसके र्ाद िेस्ट्ि ट्यूर् को िािर
र्ार् म ें 50o सेजल्सयस पर 30 जमनि तक गम वकरें।
(4) िािर र्ार् स े जनकालने के र्ाद 765 एनएम पर स्ट्पेक्रोफोिोमीिर का उपयोग करके अििोिण को मापें।
(5) संदभव के रूप में गैजलक एजसड या फ़्लोरोग्लुसीनॉल का उपयोग करत े हुए उपरोि जिजध स े एक मानक िक्र (40-
200 जम.ग्रा./लीिर) तैयार करें।
(6) गैजलक एजसड या फ़्लोरोग्लुसीनॉल समकक्ष म ेंफेनोजलक यौजगकों की सांरता को व्यि करें।
11.4 गणना
कुल फेनोजलक्स की गणना जम.ग्रा. गैजलक एजसड समतल्ु य (िीएएस)/ग्राम नमून े के रूप म ेंकरें
िीएएस (जम.ग्रा./ग्राम) = सी x िी/एम
िहा,ँ
सी = कैजलिेिन िक्र स ेप्राप्त गैजलक एजसड की सांरता जम.ग्रा./जमजललीिर म ें
िी = नमनू े की मात्रा जम.ली. म ें
एम = ग्राम में नमून े का भार
11.5 सदं भ व
कुजपना एस, फील््स सी, रोमन एमसी 2019. फोजलन-सी-एस ेका उपयोग करके कुल फेनोजलक सामग्री का जनधावरण:
सोइंगल प्रयोगिाला सत्यापन, फस्ट्िव एक्िन 2017.13. िनवल ऑफ एओएसी इंिरनेिनल। 101: पीपी 1466- 1472.
12. ह्यजु मक एजसड और फुजल्िक एजसड का अिधारण
12.1 उपकरण
(क) एनाजलरिकल र्लै ेंस
(ख) ड्राइंग ओिन
(ग) उच्च गजत सेंरीफ्यूि
(घ) रोिेरी ईिोपरेिर
(ङ) पीएच मीिर[भाग II—खण्ड 3(ii)] भारत का रािपत्र : असाधारण 11
(च) स्ट्पेक्रोफोिोमीिर
(छ) पेररस्ट्िाजल्िक पम्प
(ि) मफल भट्टी
(झ) रोिेरिंग िेककंग जमक्सर
(ञ) डेसीकेिर
12.2 रसायन और अजभकमकव जमिण
(क) सोजडयम हाइड्रॉक्साइड
(ख) हाइड्रोक्लोररक एजसड
(ग) नाइरोिन गैस- 99.96% िुद्धता
(घ) सुपेल्को सुपरलाइि डीएएक्स-8 रेजज़न
(ङ) एम्र्रलाइि आईआर-20 स्ट्रोंग कैिन एक्सचेंि रेजज़न
12.3 प्रकक्रया
(क) क्षारीय जनष्किणव
(i) यकद सामग्री ठोस या दानेदार ह,ै तो उन्द्ह ेंपेस्ट्रल -मोिवर का उपयोग करके र्ारीक पाउडर में पीसकर जिश्लेिणात्मक
नमूने तैयार करें ताकक जपसा हुआ नमनू ा मानक छलनी िाल आकार 60 - 80 स ेछन िाए।
(ii) नमी की मात्रा का जनधावरण ग्रैजिमेररक जिजध द्वारा जनम्नित करें:
(क) एक एल्युजमजनयम िेि िॉि का ििन करें और रव्यमान (डब्लल्यिू ी 1) ररकॉडव करें;
(ख) जिश्लेिणात्मक नमून े के 2 ± 0.5 ग्राम परीक्षण भाग को िेि िॉि में स्ट्र्ानांतररत करें, ििन करें और रव्यमान
(डब्लल्य ू 1) ररकॉडव करें;
(ग) नमूने को 90° सेजल्सयस पर 24 ± 0.2 घंिे के जलए ड्राइंग ओिन में रखें; 24 घंिे के र्ाद, ड्राइंग ओिन से जनकाल ें
और 1 घंिे के जलए ठंडा करने के जलए डेसीकेिर में रखें; िेि िॉि और िुष्क परीक्षण भाग (डब्लल्य ू2) का ििन करें
और रव्यमान ररकॉडव करें।
(घ) समीकरण का उपयोग करके नमी अनुपात जनधावररत करें
नमी अनपु ात = [(डब्लल्यू1 – डब्लल्य2ू )/ (डब्लल्य1ू – डब्लल्यूिी1)]
(iii) जिश्लेिणात्मक नमूने से दसू रे परीक्षण भाग का लगभग 2-5 ग्राम ििन करें (W3: प्रयुि नमून े का सही ििन) और
इसे प्रीकैजलिेिेड या पूिव-जचजह्नत 1 लीिर एलने मेयर फ्लास्ट्क में रखें (रिप्पण: जलए गए परीक्षण नमून े में लगभग
2.5 ग्राम ह्युजमक एजसड होना चाजहए)।
(iv) 0.1M सोजडयम हाइड्रॉक्साइड (यानी, 4 ग्राम सोजडयम हाइड्रॉक्साइड/ 1 लीिर जडजस्ट्िल्ड िािर) को जहलाते हुए
जमलाएँ, और अतं म ें1 लीिर मात्रा तैयार करें। समीकरण का उपयोग करके परीक्षण भाग का सूखा ििन जनधावररत
करें:
िुष्क परीक्षण भाग का िुष्क भार = (डब्लल्य3ू ) (1 – नमी अनुपात)
(v) तरल पदार्ों के जलए, जिश्लेिणात्मक नमून ेको कांच की छड़ स े1 जमनि तक जहलाकर अच्छी तरह जमलाएं, और यह
सुजनजश्चत करें कक कंिेनर के नीचे जगरा हुआ कोई भी अििेि अच्छी तरह से जमजित हो गया हो।
(vi) जिश्लेिणात्मक नमूने के परीक्षण भाग के एक अंि को, आयतन (िी1) को ध्यान में रखते हुए, एक प्रीकैजलिेिेड या
पूि-व जचजह्नत एक लीिर एलेनमये र फ्लास्ट्क म ेंडालें, तर्ा 0.1M सोजडयम हाइड्रॉक्साइड के सार् अतं म ेंएक लीिर
मात्रा तक ल ेआय;ें
रिप्पण: परीक्षण भाग में 0.1M सोजडयम हाइड्रॉक्साइड के सार् घोलने के र्ाद 200 से 600 जम.ग्रा./लीिर ह्युजमक
एजसड तर्ा फुजल्िक एजसड की सांरता होनी चाजहए। इसजलए, अंि की मात्रा ह्युजमक एजसड और फुजल्िक एजसड
उत्पाद सांरता पर आधाररत होगी, जिसका दािा िेस्ट्ि सैम्पल द्वारा ककया गया होगा।
(vii) एक प्रीिारड ग्रेिुएिेड जसलेंडर (डी1) म ें अच्छी तरह स े जमजित जिश्लेिणात्मक नमनू े के 10 जमजललीिर का ििन
करके तरल पदार् वका घनत्ि (ग्राम/जमजललीिर) जनधावररत करें। समीकरण का उपयोग करके तरल परीक्षण भाग का
ििन जनधावररत करें
रि परीक्षण भाग का ििन (ग्राम) = (िी1) (डी1)
(viii) 0.8 से 1.2 सेमी लंर्ा चुंर्कीय स्ट्िर र्ार िोड़,ें हडे स्ट्पेस म ेंहिा के स्ट्र्ान पर नाइरोिन डालें, और पैराक़िल्म से ढक
द,ें स्ट्िर प्लेि पर तीव्रता से जमलाएं (िैसे, 200-300 आरपीएम)। ह्यूजमक पदार्ों को जनकालन ेके जलए ठोस नमूनों12 THE GAZETTE OF INDIA : EXTRAORDINARY [PART II—SEC. 3(ii)]
को 6 घंिे तक जहलाएं और सभी ह्युजमक एजसड और फुजल्िक एजसड के जिघिन को सुजनजश्चत करने के जलए तरल
नमूनों को 1 घंिे तक जहलाएं।
(ix) इस बर्ंद ुसे आग,े ठोस और तरल दोनों नमूनों के जलए जिजध एकसमान ह।ै
(x) जमिण करने के र्ाद, फ्लास्ट्क को जमिण प्लेि स े हिा लें, सामग्री को सेंरीफ्यूि ट्यूर् म ें स्ट्र्ानांतररत करें, तर्ा घलु े
हुए ह्युजमक एजसड और फुजल्िक एजसड से ककसी भी अघुलनिील पदार् व को अलग करन े के जलए संपणू व मात्रा को
सेंरीफ्यूि कर लें।
(xi) 3900×िी पर 10 जमनि के जलए सेंरीफ्यूि करें (50 जमजललीिर सेंरीफ्यूि ट्यूर् या उपलब्लध र्ड़ी ट्यूर् का उपयोग
करें)। अघलु निील अिक्षेपों को अलग करे और ह्युजमक एजसड और फुजल्िक एजसड युि क्षारीय सुपरनेिेंि को एक
साफ 1 लीिर एलने मेयर फ्लास्ट्क में इकट्ठा करें।
(xii) िर् एक्सरेक्ि घोल को स्ट्िर र्ार से जमलाया िा रहा हो, तो घोल के र्ीच िाल े जहस्ट्से म ें सािधानी से पीएच
इलेक्रोड डालें। ह्युजमक एजसड को फ़्लोक्यलू ेि करन ेके जलए, क्षारीय अकव में सांर हाइड्रोक्लोररक एजसड (1:1) र्ूंद-
र्ूंद करके तर् तक जमलाएँ िर् तक पीएच 1.0 ± 0.05 न हो िाए।
(xiii) फ्लास्ट्क को परै ाकफल्म से ढकें और 1 घंिे तक जमलाएँ। पीएच िाँचें और यकद आिश्यक हो तो अजतररि सांकरत
हाइड्रोक्लोररक एजसड (1:1) के सार् पीएच 1.0 पर पुनः समायोजित करें। यकद पीएच 0.95 से नीचे आ िाए, तो
0.1M सोजडयम हाइड्रॉक्साइड घोल के सार् पीएच को िापस 1.0 ± 0.05 पर समायोजित करें तर्ा अम्लीकृत
एक्सरेक्ि को जमलात े रह ेंऔर पीएच को कभी-कभी तर् तक िाँचते रह ेंिर् तक कक यह 5 जमनि के जलए पीएच =
1 ± 0.05 पर जस्ट्र्र न हो िाए; और
(xiv) एक र्ार पीएच जस्ट्र्र हो िाए तो, फ्लास्ट्क को जमक्सर से जनकालें और पैराकफल्म से ढक दें। जमिण को तर् तक
जर्ना जहलाए रहन ेद ेंिर् तक अिक्षेजपत ह्युजमक एजसड फ्लास्ट्क के तल पर न िम िाए।
(रिप्पण: ह्युजमक एजसड के घोल से अिक्षेजपत होने का समय उत्पादों के र्ीच र्हुत जभन्न होता ह,ै परंतु एक सामान्द्य समय
सीमा 1 से 6 घंिे होती ह।ै
(ख) ह्यजु मक एजसड का पर्ृ क्करण
(i) एक र्ार िर् ह्युजमक एजसड परू ी तरह से अिक्षेजपत हो िाए, तो फुजल्िक एजसड यिु एक्सरेक्ि (फुजल्िक फ्रैक्िन)
को एक साफ 01 लीिर एलेनमेयर फ्लास्ट्क में छान लें, ध्यान रह े कक ह्युजमक एजसड अिक्षेप में स े कुछ भी इसम ें
िाजमल न हो। कुछ उत्पादों के सार्, अिक्षेजपत ह्युजमक एजसड कोलाइडल कणों के रूप म ें सस्ट्पेंिन में रहगे ा। यकद
ऐसा ह,ै तो अम्लीय फुजल्िक फ्रैक्िन से फ्लोकुलेिेड ह्युजमक एजसड को अलग करन े के जलए परू ी मात्रा को सेंरीफ्यूि
करें।
(ii) र्चे हुए जमिण को सेंरीफ्यूि ट्यूर् में डालें और ह्युजमक एजसड अिक्षेप को अलग करने के जलए 0.5 घंिे के जलए
3900×िी पर सेंरीफ्यूि करें।
रिप्पण: यकद आिश्यक हो तो ह्युजमक एजसड अिक्षेप से फुजल्िक अकव सुपरनैिेंि को साफ अलग करन ेके जलए उच्च िी
र्ल या लंर्े सेंरीफ्यूिेिन समय का उपयोग ककया िा सकता ह)ै।
(iii) फुजल्िक एजसड युि अम्लीकृत अकव में सुपरनैिेंि जमलाएं।
(ग) ह्युजमक एजसड सांरता का जनधावरण:
(i) अिक्षेजपत ह्युजमक एजसड युि सेंरीफ्यूि ट्यूब्लस को 90° सेजल्सयस पर सेि ककए गए ड्राइंग ओिन म ें रखें, और
ह्युजमक एजसड को जस्ट्र्र िज़न तक सुखाएँ (आमतौर पर 24 घंिे)। जस्ट्र्र िज़न तर् प्राप्त होता ह ै िर् ट्यूर् और
ह्युजमक एजसड (या फुजल्िक एजसड) का िज़न अजतररि 2 घंिे सुखाने के र्ाद समान हो िाता है; और
(ii) सुखाने के र्ाद, ट्यूर्ों को ड्राइंग ओिन स े जनकाल ें और कमरे के तापमान पर ठंडा होन े के जलए डेसीकेिर म ें रखें।
ठंडा होने के र्ाद, ट्यूर् के ककनारों और नीचे से स्ट्पैिुला से स्ट्क्रैप करके अििेिों को मात्रात्मक रूप से ट्यूर् स े
स्ट्र्ानांतररत करें, एक िाड व िेि िॉि में स्ट्र्ानांतररत करें, और रव्यमान (डब्लल्य4ू एचए) ररकॉडव करें। यह अििेि
"एक्सरेकिेड ह्युजमक एजसड " ह।ै
(घ) राख सामग्री का जनधारव ण[भाग II—खण्ड 3(ii)] भारत का रािपत्र : असाधारण 13
(i) एक्सरेकिेड ह्युजमक एजसड को एक पहल ेसे तलु ेहुए (डब्लल्यूिी2) जसरेजमक जडि म ेंस्ट्र्ानांतररत करें, जिसे पहल े90
जडग्री सेजल्सयस पर सेि ककए गए ड्राइंग ओिन म ेंसुखाया गया र्ा और कफर कमरे के तापमान तक एक डेसीकेिर म ें
ठंडा ककया गया र्ा।
(ii) एक्सरेकिेड ह्युजमक एजसड और जडि (डब्लल्य5ू ) के संयुि रव्यमान को ररकॉड व करें और जडि को कम्र्िन के जलए
500° सेजल्सयस पर 4 घंिे के जलए मफल ओिन में स्ट्र्ानांतररत करें।
(iii) गमव मफल ओिन से जडि और सामग्री को जनकालें और ठंडा होने के जलए डेसीकेिर में रखें। ठंडा होने के र्ाद, जडि
को राख (डब्लल्य6ू ) सजहत जडि का तौलें करें और समीकरण द्वारा राख अनुपात की गणना करें
राख अनपु ात = [(डब्लल्यू5 – डब्लल्य6ू )/( डब्लल्य5ू – डब्लल्यूिी2)]
(iv) जनम्न समीकरण का उपयोग करके राख सामग्री को सही करके एक्सरेकिेड ह्युजमक एजसड के अंजतम रव्यमान का
जनधावरण करें
राख के जर्ना एक्सरेकिेड ह्युजमक एजसड का ििन (ग्राम) = (डब्लल्य4ू एचए)(1–राख अनुपात)
(ङ) फुजल्िक एजसड का पर्ृ क्करण
(i) नॉनआयजनक मैक्रोपोरस ऐक्रेजलक एस्ट्िर रेजिन (यानी, सुपले ाइि डीएएक्स-8) के सार् तैयार 40 × 250 जममी
ग्लास का उपयोग करके फुजल्िक फ्रैक्िन म ेंअन्द्य एजसड-घलु निील यौजगकों स ेफुजल्िक एजसड को अलग करें।
रिप्पण: चयनात्मक अजधिोिण के माध्यम स,े हाइड्रोकफजलक एजसड-घलु निील घिक रेजसन के सार् िुडत ेनहीं
ह ैंऔर हिा कदए िाते ह।ैं
(ii) फुजल्िक फ्रैक्िन को कॉलम के िीिव से, कम दर्ाि में, एक पेररस्ट्िाजल्िक पंप का उपयोग करके कॉलम के माध्यम
से पास करें। यह महत्िपूण व ह ै कक कॉलम म ें रेजसन का िीि व घोल स े ढका रह े िर् तक कक रेजसन को सूखन े स े
रोकने के जलए परू ा एक्सरेक्ि जमल न िाए।
(iii) एक र्ार िर् फुजल्िक फ्रैक्िन परू ी तरह स ेरेजिन म ेंभर िाता ह,ै तो कम दर्ाि में पेररस्ट्िाजल्िक पंप का उपयोग
करके कॉलम के िीि वके माध्यम स ेइस ेपंप करके डीआयोनाइस्ट्ड पानी से रेजिन को धो ल ेंतर्ा अपजिष्ट को हिा
द।ें
(iv) कॉलम को तर् तक धोएँ िर् तक कॉलम के प्रिाह के 350एनएम पर अििोिण कॉलम को धोने के जलए उपयोग
ककए गए डीआयोनाइस्ट्ड िल के र्रार्र (उदाहरण के जलए, 0.015 अििोिण इकाइयों के भीतर) न हो िाए।
350एनएम की तरंगदैर्घयव फुजल्िक एजसड द्वारा मिर्ूत अििोिण देता ह ैऔर एक स्ट्पेक्रोफोिोमीिर के उपयोग
की अनुमजत देता ह ैिो केिल दश्ृ य तरंगदैर्घयव को मापता ह।ै
(v) पेररस्ट्िाजल्िक पंप का उपयोग करके 0.1M सोजडयम हाइड्रॉक्साइड पंप करके र्ैक एल्यूिन (यानी, कॉलम के
तल में डाला गया इन्द्फ्लूएंि) द्वारा फुजल्िक एजसड को सोखें। अजधकांि फुजल्िक एजसड डीएएक्स-8 रेजसन के
र्हुत ऊपर तक अििोजित हो िाता ह।ै कॉलम तल से जििोिण फुजल्िक एजसड को परू ी तरह से सोखने के जलए
0.1M सोजडयम हाइड्रॉक्साइड की न्द्यूनतम मात्रा का उपयोग करता ह।ै
(vi) िर् कॉलम के र्जहःस्राि का अििोिण 350एनएम पर अतं िावह के अििोिण के र्रार्र होता ह,ै तो सभी
फुजल्िक एजसड को हिा कदया िाता ह।ै स्ट्पेक्रोफोिोमेररक ब्ललकैं के रूप म ें 0.1M सोजडयम हाइड्रॉक्साइड का
उपयोग करें और जनष्कर्िवत फुजल्िक एजसड घोल के अििोिण को रोकने के जलए जलया गया र्जहःस्राि जमलाएँ।
(vii) 5 × 50 सेमी कॉलम म ें जनजहत एम्र्रलाइि आईआर120 हाइड्रोिन फॉमव आयन एक्सचेंि रेजसन के माध्यम स े
र्ार-र्ार (गरुु त्िाकिवण ़िीड द्वारा) गुिारकर फुजल्िक एजसड को प्रोिोनेि और डी-ऐि करें िर् तक कक प्रिाह
की जिद्युत चालकता <120 uS/m न हो िाए, िो कक चालकता मीिर से मापा िाता ह।ै
(viii) यह सुजनजश्चत करने के जलए कक अंजतम पास के र्ाद रेजसन से सभी फुजल्िक एजसड हिा कदए गए ह,ैं कॉलम को
डीआयोनाइस्ट्ड पानी से तर् तक धोएँ िर् तक कक 350एनएम पर अपजिष्ट का अििोिण कॉलम को धोने के
जलए उपयोग ककए गए डीआयोनाइस्ट्ड पानी के समान (उदाहरण के जलए, 0.015 अििोिण इकाइयों के भीतर)
न हो िाए। स्ट्पेक्रोफोिोमेररक ब्ललैंक के रूप में डीआयोनाइस्ट्ड पानी का उपयोग करें। िुद्ध फुजल्िक एजसड घोल
में अििोिण को रोकने के जलए जलया गया िॉि और कोई भी इफ्लूएंि भाग जमलाएँ।
(ix) सभी फुजल्िक एजसड को हिाने में मदद करन े के जलए, रेजसन को कई र्ार जहलाया िाना चाजहए (उदाहरण के
जलए, एक लंर्ी कांच या प्लाजस्ट्िक की छड़ का उपयोग ककया िा सकता ह)ै
(x) 55° सेजल्सयस पर रोिरी एिेपोरेिर का उपयोग करके फुजल्िक एजसड को लगभग 15 ± 2 जमजललीिर की मात्रा
तक सांकरत करें।14 THE GAZETTE OF INDIA : EXTRAORDINARY [PART II—SEC. 3(ii)]
(xi) 15 जमली लीिर फुजल्िक एजसड सांर को 50 जमली लीिर प्लाजस्ट्िक सेंरीफ्यूि ट्यूर् में पूरी तरह से स्ट्र्ानांतररत
करें और ड्राइंग ओिन म ें 90 जडग्री सेजल्सयस पर लगातार सुखाएं। (फ़्रीज़ ड्राइंग ओिन ड्राइंग का एक जिकल्प
ह।ै ); तर्ा
(xii) सुखाने के र्ाद, िैसा कक ऊपर ह्युजमक एजसड के जलए िर्णवत ह,ै ट्यूर् को ठंडा होन े के जलए डेसीकेिर में रखें।
ट्यूर् के ककनारों और जनचल े जहस्ट्से को स्ट्पैिुला से पूरी तरह खरु च कर ट्यूर् स े फुजल्िक एजसड जनकाल ें और इस े
पहले स ेतैयार ििन कागि (डब्लल्यू8) पर तौलें तर्ा यह पदार् व"जनष्कर्िवत फुजल्िक एजसड" ह।ै
(xiii) जनष्कर्िवत फुजल्िक एजसड की अिजिष्ट राख सामग्री को ह्युजमक एजसड के जलए ऊपर िर्णवत अनुसार जनधावररत
करें और राख अनुपात की गणना करें।
(xiv) अंत म,ें समीकरण का उपयोग करके राख के जर्ना जनष्कर्िवत फुजल्िक एजसड का ििन जनधावररत करें:
राख के जर्ना जनष्कर्िवत फुजल्िक एजसड का ििन (ग्राम) = (डब्लल्य4ू फुजल्िक एजसड)(1-राख अनुपात)
(च) कॉलम ररिने रे ेिन
(i) 0.1M हाइड्रोक्लोररक एजसड [8.33 जमली लीिर सांकरत हाइड्रोक्लोररक एजसड/1000 जमली लीिर अंजतम आयतन
डीआयोनाइस्ट्ड (डी. आई.) िल] को कॉलम की जनचली सतह से पंप करके डीएएक्स-8 रेजिन को ररिेनेरेि करें िर्
तक कक अपजिष्ट का पीएच प्रिाह के पीएच के र्रार्र न हो िाए। ररिेनेरेिन के दौरान डीएएक्स-8 कॉलम के
माध्यम से सभी अजभकमवकों को पंप करन े के जलए पेररस्ट्िाजल्िक पंप का उपयोग करें।
(ii) इसके र्ाद कॉलम के िीिव भाग में डी.आई. िल को पंप करके कॉलम को तर् तक धोए ं िर् तक कक र्जहःस्राि का
पी.एच. प्रिाह के पी.एच. (अर्ावत् जिआयनीकृत िल) के पी.एच. के र्रार्र न हो िाए।
(iii) र्ैच प्रकक्रया म ेंएच+ फॉम वकेिन एक्सचेंि रेजसन को ररिेनेरेि करन ेके जलए रेजसन को एक र्ड़ ेर्ीकर (िैस,े 4 लीिर
प्लाजस्ट्िक र्ीकर) म ेंडालें, पानी को जनकाल द,ें और रेजसन को 1M हाइड्रोक्लोररक एजसड (83.3 जमजललीिर सांकरत
हाइड्रोक्लोररक एजसड/1000 जमजल लीिर अंजतम आयतन जिआयनीकृत िल) से भर द।ें
(iv) इसे कम से कम 30 जमनि तक ऐसे ही रहने द ेंऔर र्ीच-र्ीच में जहलात ेरह ें(िैस,े हर 5 जमनि में एक र्ार)। एजसड
को डालकर और रेजिन को जिआयनीकृत िल िल से भरकर रेजिन से अजतररि एजसड को हिा दें।
(v) 15 सेकंड के जलए एक स्ट्िररंग रॉड स े तेि-तेि जहलाए,ं कफर रेजसन और रेजसन पानी को 5 जमनि के जलए र्ैठने दें।
प्रकक्रया को तर् तक दोहराएं िर् तक रेजसन पानी का पीएच डीआई पानी के पीएच के र्रार्र न हो िाए।
(vi) ररिेनेरेिेड रेजिन को िापस कॉलम में भर दें। भरने के र्ाद, रेजिन को जिआयनीकृत िल िल से धोएँ और अपजिष्ट
िल का पीएच िाँचें। यकद यह कॉलम से गुिरने से पहले जिआयनीकृत िल िल के पीएच से कम ह,ै तो कॉलम को
जिआयनीकृत िल िल से तर् तक धोना िारी रखें िर् तक कक अपजिष्ट िल का पीएच प्रिाह के पीएच के 0.1
पीएच इकाइयों के भीतर न हो िाए।
12.4 सदं भ व
लैमर आर.िी., ओल्क डी.सी., मेह्यू एल. और ब्ललूम पी.आर. 2014. ए न्द्य ू स्ट्िैंडडवज़डे मेर्ड फॉर क्वान्द्िीकफकेिन
ऑ़ि ह्यूजमक एंड फुलजिक एजस्स इन ह्यूजमक ओसव एडं कमर्िवयल प्रोडक््स । िनवल ऑफ एओएसी इंिरनिे नल
97 (3): 721- 730.
13. कुल फ्री अमीनो एजसड का अिधारण
13.1 उपकरण
(क) िािर र्ार्/ड्राई ब्ललॉक र्मोस्ट्िेि
(ख) स्ट्पेक्रोफोिोमीिर
(ग) सेंरीफ्यूि
(घ) एनाजलरिकल र्लै ेंस
13.2 रसायन और अजभकमकव
(क) जननहाइजड्रन (सीएएस नं 485-47-2)
(ख) हाइबड्रंडैंरिन (सीएएस न ं 5103-42-4)
(ग) ग्लाइजसन (सीएएस नं 56-40-6)
(घ) एजसरिक एजसड (सीएएस नं: 64-19-7)[भाग II—खण्ड 3(ii)] भारत का रािपत्र : असाधारण 15
(ङ) पोिेजियम एसीिेि (सीएएस नं : 127-08-2)
(च) डाइमेजर्ल सल़्िोक्साइड (DMSO) (सीएएस न:ं 67-68-5)
(छ) 2-प्रोपेनॉल (सीएएस न:ं 67-63-0)
(ि) जडजस्ट्िल्ड िल
(झ) 2-प्रोपेनॉल/पानी = 1/1 (िी/िी) (500 जम. ली. 2-प्रोपेनॉल को 500 जम. ली. पानी के सार् जमलाएं)
(ञ) एसीिेि र्फर: 98.1 ग्राम पोिेजियम एसीिेि और 111 जमली लीिर ग्लेजियल एजसरिक एजसड को पानी म ेंघोलकर
अंत म ें500 जमली लीिर की मात्रा प्राप्त करें।
(ि) जननहाइजड्रन अजभकमवक: 550 जम.ग्रा. जननहाइजड्रन और 22 जम.ग्रा. हाइजड्रनडेंरिन को 11 जमली लीिर
डीएमएसओ म ेंघोलें। घोल को 11 जमली लीिर एसीिेि र्फर के सार् जमलाएं। अजभकमवक को तैयार करन े के तरु ंत
र्ाद इस्ट्तेमाल करें।
(ठ) ग्लाइजसन स्ट्िैन्द्डड व घोल (10000 म्य ू ग्रा./जम.ली.): ग्लाइजसन स्ट्िैन्द्डड व का 100 जम.ग्रा. ििन करें और इस े 10
जमजललीिर िॉल्यूमेररक फ्लास्ट्क में डालें। इसे र्ोड़ी मात्रा में जडजस्ट्िल्ड िल म ेंघोलें और जडजस्ट्िल्ड िल से मात्रा को
100 जमजललीिर तक र्ढ़ाएँ।
(ड) नमूना जिलयन - जिश्लेिण हते ु नमूने का 1 ग्राम 100 जमली िॉल्यूमेररक फ्लास्ट्क म ें ल,ें इसे र्ोड़ी मात्रा म ें आसुत
िल में घोल,ें आसुत िल के सार् आयतन 100 जम. ली. करें, आधे घंिे तक जहलाकर सामग्री को अच्छी तरह जमलाए ं
और यकद आिश्यक हो तो नमनू े को डायल्यूि करें और गणना म ें डायल्यूसन फेक्िर (डीएफ) का उपयोग करें।
13.3 प्रकक्रया
(i) ग्लाइजसन मानक घोल (10000 पीपीएम) की जिजभन्न मात्रा (10 माइक्रोलीिर . , 20 माइक्रोलीिर, और इसी
तरह) को िेस्ट्ि ट्यूर् की एक िखृं ला में जपपेि करें और जडजस्ट्िल्ड िल के सार् मात्रा को 1 जम. ली. लीिर तक तैयार
कर लें। यह 10, 20, 30, 40, 50, 60, 70, 80, 90 और 100 एमिी/जमजललीिर की कायविील मानक सांरता
देता ह)ै
(ii) 1.5 जम.ली. प्रजतकक्रया ट्यूर् म ें200 माइक्रोलीिर नमनू ा या मानक लें और इसमें 800 माइक्रोलीिर जननहाइजड्रन
अजभकमवक जमलाएं।
(iii) ट्यूर्ों को 10 सेकंड के जलए सेंरीफ्यूि करें ताकक यह सुजनजश्चत हो सके कक ट्यूर्ों के ढक्कनों में जमिण की कोई र्ूंद न
रह िाए।
(iv) ट्यूर्ों को ऊपर से ढक्कन से ढक दें और उन्द्ह ें ड्राई ब्ललॉक र्मोस्ट्िेि में या 90o सेजल्सयस तापमान पर 45 जमनि के
जलए िािर र्ार् में रखें।
(v) ट्यूर्ों को कमरे के तापमान तक ठंडा करें और ठीक 500 माइक्रोलीिर को 3 जमजललीिर क्यूििे में डाल ेंतर्ा इसम ें
2.5 जमजललीिर 2-प्रोपने ॉल/पानी का जमिण 1:1 अनुपात (िी/िी) म ेंजमलाएँ। सामग्री को अच्छी तरह जमलाएँ।
(vi) ब्ललेंक के सापेक्ष 570 एनएम पर जिलयनों का ऑजप्िकल घनत्ि मापें।
(vii) अमीनो एजसड सांरता के जिरुद्ध अििोिण का एक मानक िक्र तैयार करें। और
(viii) िाई-अक्ष पर A570 का मानक िक्र तर्ा एक्स-अक्ष पर अमीनो अम्ल की सांरता अंककत करके अज्ञात नमून े म ें
अमीनो एजसड की मात्रा जनधावररत करें।
13.4 गणना
जनम्न सूत्र का उपयोग करके कुल अमीनो एजसड मात्रा की गणना करें
ग्राफ द्वारा सांरता (जम.ग्रा./लीिर) x मेक अप िॉल्यूम x डीएफ (यकद कोई हो)
सांरता (जम.ग्रा./कक.ग्रा) =
नमूने का ििन (ग्राम)
सांरता (जम.ग्रा./कक.ग्रा)
पररणाम % म ें=
1000016 THE GAZETTE OF INDIA : EXTRAORDINARY [PART II—SEC. 3(ii)]
13.5 सदं भ व
स्ट्िॉसß, ए.सी., फुच्स, सी., िानसन, पी., ररपिव, एस., एल्कॉक, के., लडु जिग, एस., रोज़होन, डब्लल्य.ू 2024. द
जननहाइजड्रन ररएक्िन रीजिजसिेड:ऑजप्िमाइिेिन एडं एप्लीकेिन फोर कांरिकफकेिन ऑ़ि फ्री एजमनो
एजस्स.मोलेक्युल्स 29, 3262.
14. फ्री अमीनो एजसड का अिधारण (जिजिष्ट अमीनो एजसड के जलए)
फ्लोरोसेंस जडिेक्िर और एसीसीक्यू.िैग अल्रा-2ए अजभकमवक के सार् एचपीएलसी का उपयोग करके अमीनो एजसड
जिश्लेिण में एक ऐसी जिजध िाजमल ह ै जिसमें नमनू े से अमीनो एजसड को पहले एसीसीक्यू.िैग अल्रा-2ए अजभकमवक
के सार् रासायजनक रूप से व्युत्पन्न (लेर्ल) ककया िाता ह।ै व्युत्पन्नकरण एचपीएलसी कॉलम पर अलग ककए िाने पर
फ्लोरोसेंस द्वारा प्रत्येक अमीनो एजसड का अत्यजधक संिेदनिील होना उसके पता लगाने की अनुमजत देता ह,ै जिससे
नमूने म ेंमौिूद व्यजिगत अमीनो एजसड की सिीक मात्रा का पता लगाना संभि हो िाता ह।ै
14.1 उपकरण
(क) फ्लोरोसेंस जडिेक्िर युि यूएचपीएलसी प्रणाली। इस जिजध के जलए िैकजल्पक उपकरणों का उपयोग ककया िा सकता
ह,ै परंत ुसभी यौजगकों के पृर्क्करण को सुजनजश्चत करन ेके जलए पर्ृ क्करण ग्रेजडयेंि को अनुकूजलत करन ेकी आिश्यकता
होगी।
(ख) क्रोमैिोग्राफी कॉलम.— सी18, 3.9 जममी × 150 जममी x 4माइक्रोन (कण आकार)
(ग) अडिस्ट्िेर्ले माइक्रोजपपेि (10, 20, 200, और 1000 माइक्रोलीिर) और रिप्स।
(घ) िोिेक्स जमक्सर ।
(ङ) एनाजलरिकल र्लै ेंस .
(च) हीरिंग ब्ललॉक.
(छ) प्रयोगिाला ओिन.
14.2 रसायन और अजभकमकव जमिण तयै ार करना
(क) एसीसीक्यू.िैग अल्रा व्युत्पन्न ककि : जनमावता के अनदु ेिों का पालन करत े हुए ककि म ें िाजमल अजभकमवकों को तैयार
करें:
(1) एसीसीक्यू.िैग अल्रा र्ोरेि र्फर (अजभकमवक 1): उपयोग के जलए तैयार घोल। िैकजल्पक अजभकमवक: पानी में 5%
(डब्लल्यू/िी) सोजडयम िेरार्ोरेि और
(2) एसीसीक्यू. िैग अल्रा अजभकमवक (िीिी 2ए और 2र्ी): जनमावता के अनुदेिों के अनुसार एसीसीक्यू.िैग अल्रा
अजभकमवक (िीिी 2ए) का पुनगवठन करें:
(i) हीरिंग ब्ललॉक को 55°से तक पहले ही गम वकर लें।
(ii) खोलने स े पहल े िीिी 2ए को हल्के स े िैप करें ताकक यह सुजनजश्चत हो सके कक सभी एसीसीक्यू.िैग अल्रा
अजभकमवक पाउडर िीिी के नीचे ह।ै
(iii) िीिी 2र्ी (उपयोग के जलए तैयार सॉल्यूिन) से 1 जमली लीिर एसीसीक्यू.िैग अल्रा अजभकमवक मंदक
जनकालकर और हिाकर साफ माइक्रोजपपेि को धो ल;ें दो र्ार दोहराएं।
(iv) िीिी 2र्ी स े 1.0 जमजललीिर जनकालें, इसे िीिी 2ए म ें एसीसीक्यू. िैग अल्रा अजभकमवक पाउडर म ें डाल,ें
और िीिी को कसकर र्ंद करें। लगभग 10 सेकंड के जलए िोिेक्स जमक्सर पर जमलाएँ, और कफर िीिी 2ए
को पहले से गरम ककए गए हीरिंग ब्ललॉक के ऊपर 55°स े पर तर् तक गमव करें िर् तक एसीसीक्यू. िैग अल्रा
अजभकमवक पाउडर घलु न िाए।
रिप्पण: अजभकमवक को 10 जमनि से ज़्यादा गमव न करें।
(v) एक र्ार पुनगवरठत होने के र्ाद, एसीसीक्यू.िैग अल्रा अजभकमवक लगभग 10 mM होता ह।ै पुनगवरठत
एसीसीक्यू.िैग अल्रा अजभकमकव को कमरे के तापमान पर एक डेसीकेिर म ें 1 सप्ताह तक स्ट्िोर करें।
रिप्पण: एसीसीक्यू.िैग अल्रा अजभकमवक िायुमंडलीय नमी के सार् अभीकक्रया करता ह।ै उपयोग में न होन े
पर कंिेनर को कसकर सील करें तर्ा इसे कफ्रि में न रखें।
(ख) अमीनो एजसड मानक घोल : इसमें 2.5 μmol/जम.ली. (या 2.5 mM) प्रत्येक पर जनम्नजलजखत 17 अमीनो एजसड होत े
ह ैं (1.25 μmol/जम.ली. पर एल-जसस्ट्िीन को छोड़कर): एल-एलेजनन, एल-आर्िवजनन, एल-एस्ट्पार्िवक एजसड,
एलजसस्ट्िीन, एल-ग्लूिाजमक एजसड, एल-ग्लाइसीन, एल-जहजस्ट्िडीन, एल-आइसोल्यूसीन, एल-ल्यूसीन, एल-लाइजसन,[भाग II—खण्ड 3(ii)] भारत का रािपत्र : असाधारण 17
एल-मेजर्योनीन, एल-फेजनलएलजनन, एल-प्रोलाइन, एल सेरीन, एल-थ्रेओनीन, एल-िायरोजसन और एल-िैजलन। 2.5
mM कैजलिेिन मानक स्ट्िॉक घोल को 250 म्यू ली एजलक्वॉि के रूप म ें 6 महीने तक -20°से पर स्ट्िोर करें।
(i) 0.5 mM अमीनो एजसड सॉल्यिू न.—600 म्यू ली 0.1M हाइड्रोक्लोररक एजसड को 150 म्यू ली 2.5
mM अमीनो एजसड सॉल्यूिन म ें जमलाएं।
(ii) 0.05mM अमीनो एजसड सॉल्यिू न —100 म्यू ली 0.5 mM अमीनो एजसड घोल म ें 900 म्य ूली 0.1 M
हाइड्रोक्लोररक एजसड जमलाएं।
रिप्पण:0.5 mM और 0.05 mM अमीनो एजसड घोल दोनों ही प्रत्येक जिश्लेिण के जलए ताज़ा तैयार ककए
िाते ह ैं
(ग) क्रोमैिोग्राफी सॉल्िैं्स (मोर्ाइल फेि):
(i) एल्युएंि ए (सॉल्यिू न ए): एसीसीक्यू. िैग अल्रा एल्युएंि ए (अमोजनयम फॉमेि 84%, फॉर्मवक एजसड 6%,
एसीिोजनराइल 10%, आयतन के जहसार् से) सांरण से एल्युएंि ए इस प्रकार तैयार करें:
(1) 1 लीिर के ग्रेिुएिेड जसलेंडर में 850 जम.ली. पानी माप लें।
(2) एक अलग ग्रेिुएिेड जसलेंडर म,ें 150 जम.ली. एसीसीक्यू. िैग अल्रा एल्युएंि ए सांरण माप ल।ें
(3) कफर, सांरण को पानी म ेंडालें और अच्छी तरह जमलाएँ।
रिप्पण : एल्युएंि ए कंसन्द्रेि को एक र्ार खोलने के र्ाद, उसे लगभग 4°स ेपर कसकर र्ंद करके रखना चाजहए।
डाइल्यूि एल्युएंि ए कमरे के तापमान पर 1 सप्ताह तक जस्ट्र्र रहता ह।ै
(ii) एल्युएंि र्ी (सॉल्यूिन र्ी): एसीसीक्यू. िैग एल्युएंि र्ी (2% फॉर्मवक एजसड युि एसीिोजनराइल, मात्रा के जहसार्
से) एक कायविील घोल के रूप में कदया िाता ह;ै ककसी अजतररि जमिण की आिश्यकता नहीं होती ह।ै
रिप्पण: एल्युएंि र्ी को एक र्ार खोलने के र्ाद, लगभग 4°स ेपर कसकर र्ंद करके 1 महीन ेस ेज़्यादा समय तक
नहीं रखना चाजहए। िैकजल्पक एल्युएंि र्ी -2% (डब्लल्य/ूडब्लल्य)ू फॉर्मवक एजसड के सार् पूरक एचपीएलसी ग्रडे
एसीिोजनराइल का उपयोग करें।
(घ) िॉि सॉल्िैं्स :
(i) िीक नीडल िॉि सॉल्िैंि पानी में 5% (िी/िी)एसीिोजनराइल ह।ै
(ii) स्ट्रोंग नीडल िॉि सॉल्िैंि पानी में 95% (िी/िी)एसीिोजनराइल ह।ै
(iii) सील िॉि सॉल्िैंि पानी में 50% (िी/िी)एसीिोजनराइल ह।ै
(ङ) नमूना तैयार करना और उसका न्द्यूरीलाइज़ेिन करना-
(i) 10 जम. ली. िॉल्यूमेररक फ्लास्ट्क में लगभग 1 ग्राम (±10%) नमूना तौलें और आयतन 10 जम. ली. करें, दस
जमनि तक सोजनकेि करें;
(ii) 0.2 जम. ली. नमूना को 1.5 जम. ली. माइक्रोसेंरीफ्यूि ट्यर्ू में डालें और 0.2 जम. ली. 6एम सोजडयम
हाइड्रोक्साइड घोल और कफर 0.4 जम. ली. 0.1एम हाइड्रोक्लोररक एजसड डालें, अच्छी तरह से जमलाएं और
0.45 माईक्रोन मेम्िेन कफल्िर के माध्यम से एक अन्द्य 1.5 जम. ली. ट्यूर् में छान लें।
(च) डेररिेिाईिेिन (नमनू ों और अमीनो एजसड मानकों का)
डेररिेिाईिेिन फ्री अमीनो एजसड को अत्यजधक जस्ट्र्र डेररिेरिव्स में पररिर्तवत करता ह।ै मानकों और नमूनों को
नीच े िर्णवत प्रकक्रया स े डेररिेिाईि ककया िाता ह:ै
(i) हीरिंग ब्ललॉक को 55°स ेतक गमव करें।
(ii) एक माइक्रोजपपेि के सार्, एक साफ 12 × 32 जममी ग्लास स्ट्क्रू नेक िोिल ररकिरी िीिी म ें 70 म्य ू ली.
एसीसीक्यू. िैग अल्रा र्ोरेि र्फर डालें।
(iii) िीिी में 10 म्यू ली. कैजलिेिन मानक, न्द्यूरीलाइज्ड नमूना सॉल्यूिन डालें।
(iv) िोिेक्स जमक्सर पर र्ोड़ी देर के जलए जमलाएं।
(v) नमूना िीिी म ें20 म्यू ली. पनु गवरठत एसीसीक्यू. िैग अल्रा अजभकमवक डालें।
(vi) घोल को तुरंत ऊपर-नीचे कई र्ार पाइप करके जमलाएँ।18 THE GAZETTE OF INDIA : EXTRAORDINARY [PART II—SEC. 3(ii)]
(vii) ढक्कन र्ंद करें, तुरंत िोिेक्स जमक्सर पर कई सेकंड के जलए जमलाएँ, और यह सुजनजश्चत करने के जलए िीिी
को र्पर्पाएँ कक कोई र्लु र्ुला फँसा न हो।
(viii) कमरे के तापमान पर 1 जमनि तक रखें। और
(ix) िीिी को हीरिंग ब्ललॉक म ें55 ± 1° सेजल्सयस पर 10 जमनि तक गम वकरें।
(छ) अल्रा-हाई-पफोबमंग जलकक्वड क्रोमोिोग्राफी (यूएचपीएलसी) पृर्क्करण
(i) साल्िेंि लाइनों को 5 जमनि तक प्राइम करें ।
(ii) चार चक्रों के जलए धलु ाई/नमूना जसररंि को प्राइम करें ।
(iii) मानकों और नमूनों को इंिेक्ि करने से पहले क्रोमैिोग्राक़िक जसस्ट्िम को जस्ट्र्र होन े दें। इंिेक्िन लगान े स े
पहले सुजनजश्चत करें कक जसस्ट्िम का दर्ाि और प्रारंजभक जस्ट्र्जतयाँ जस्ट्र्र ह ैं(लगभग 9000 पी एस आई)।
(iv) जिश्लेिण की िृंखला िुरू करन ेसे पहल,े कॉलम का अनुकूल करने के जलए दो ब्ललेंक (पानी) डालें।
(v) प्रत्येक व्युत्पन्न कैजलिेिन मानक म ेंसे 1 माइक्रोलीिर इंिेक्ि करें और कफर 1 माइक्रोलीिर. व्यत्ु पन्न नमनू ा
सॉल्यूिन इंिेक्ि करें।
(vi) एकल इंिेक्िन करें। प्रत्येक कैजलिेिन िृंखला के अंत म ेंएक ब्ललैंक इंिेक्िन (पानी) िोड़ें।
(vii) सारणी म ें दी गई जस्ट्र्जतयों के तहत अल्रा-हाई-पफोबमंग जलकक्वड क्रोमोिोग्राफी (यूएचपीएलसी) का
जनष्पादन करें और उपकरण के आधार पर प्रचालन जस्ट्र्जतयाँ जभन्न हो सकती ह।ैं (आपूर्तवकताव के
जनयमािली का पालन करें।)
सारणी: क्रोमिै ोग्राकफक जस्ट्र्जत
(i) यंत्र एचपीएलसी
(ii) जडिेक्िर एफएलडी (फ्लरू ेसेंस जडिेक्िर)
(iii) कॉलम िािसव नोिा-पैक सी18, 150 जममी x 3.9 जममी, 4 माइक्रोन
(कण आकार)
(iv) कॉलम तापमान 30o सेजल्सयस.
(v) प्रिाह दर 1 जम. ली./जमनि
(vi) पंप मोड ग्रेजडएंि
(vii) रन िाइम 60 जमनि
(viii) िेिलेंर् एक्साइिेसन - 250 एनएम और इमीसन - 395 एनएम
(ix) इंिेक्िन मात्रा 5 माइक्रोलीिर
सारणी (ग्रजे डएंि)
क्रं. स.ं समय % ए % र्ी
(i) 0.00 99 1
(ii) 0.50 98 2
(iii) 14 93 7
(iv) 18 90 10
(v) 21 90 10
(vi) 33 78 22
(vii) 39 77 23
(viii) 42 67 33[भाग II—खण्ड 3(ii)] भारत का रािपत्र : असाधारण 19
(ix) 49 67 33
(x) 50 30 70
(xi) 52 30 70
(xii) 53 99 1
(xiii) 60 99 1
(ि) पीक पहचान और एकीकरण.-
(i) केजलिेसन मानकों म ेंप्राप्त संगत पीक के अिधारण समय के सार् तलु ना करके नमूना घोल म ेंअमीनो एजसड पीक
की पहचान करें; और
(ii) िाँच करें कक पीक एक अच्छे ररज़ॉल्यूिन (र्ेसलाइन पर्ृ क्करण) के सार् अलग हो रही ह ैंऔर यकद ऐसा नहीं ह,ै तो
क्रोमैिोग्राकफक जस्ट्र्जतयों (िैसे, स्ट्लोप, तापमान, ट्यूबर्ंग की लर्ं ाई, आकद) को तदनुसार अनुकूजलत करें।
14.3 गणना:
नमूने के सार्-सार् मानक के जलए एचपीएलसी में देखे गए पीक ररस्ट्पोंसेि को संयोजित करें और सूत्र का उपयोग करके
प्रत्येक अमीनो एजसड की गणना करें:
सैंपल क्षेत्र x मानक सांरता
एजमनो एजसड जम.ग्रा./ग्राम म=ें
मानक क्षेत्र x सैंपल ििन
एजमनो एजसड जम.ग्रा./ग्रा. x 100 म ें
अमीनो एजसड % (डब्लल्य/ूडब्लल्य)ू =
1000
14.4 सदं भ:व
िौडज़ेम्स िी और िे गुर्री 2019. इंफैन्द्ि ़िॉमूवला और एडल्ि न्द्यूररिनल्स में यूएचपीएलसी-यिू ी द्वारा कुल अमीनो
एजसड, ़िस्ट्िव एक्िन 2018.06. िनलव ऑ़ि एओएसी इंिरनेिनल 102: 1574- 1588.
15. कुल अमीनो एजसड का अिधारण (कुल नाइरोिन स)े
(1) कुल नाइरोिन (नाइरेि मुि नमूनों में) के अिधारण के जलए अनुसूची II के भाग ख के परै ा 3 में र्ताए गए प्रोिोकॉल
का पालन ककया करें।
(2) उि प्रोिोकॉल के अनुसार अिधाररत कुल नाइरोिन का उपयोग, जनम्न सूत्र का उपयोग करते हुए, फोम्युवलेिन म ें
कुल अमीनो एजसड के आकलन के जलए ककया िाना चाजहए:
क्रूड प्रोिीन (%) = कुल नाइरोिन (केिल्े डाहल जिजध द्वारा आकजलत) x 6.25
रिप्पण: सभी अमीनो एजसड म ें16% नाइरोिन होता ह;ै इसजलए गुणन कारक 6.25 (100/16) के रूप में जनकाला
और उपयोग ककया िाता ह।ै
(3) प्रोिीन हाइड्रोलाइज़ेि सैंपल में, नाइरोिन की 70% मात्रा अमीनो एजसड से होती ह।ै क्रूड प्रोिीन की गणना करन े
के र्ाद, अमीनो एजसड की मात्रा की गणना इस प्रकार करें:
अमीनो एजसड (%)= क्रूड प्रोिीन x (70/100)
16. मायो-इनोजसिोल का अिधारण
16.1 उपकरण
(क) कॉलम के सार् एचपीएलसी, एजमनो (250 एम एम x 4.6एम एम ); 5 माइक्रोन(कण आकार)
(ख) एिेपोरेरिि लाइि स्ट्केिररंग जडिेक्िर (इएलएसडी)
(ग) एनाजलरिकल र्लै ेंस
(घ) 0.22 माइक्रोन जसररंि कफल्िर20 THE GAZETTE OF INDIA : EXTRAORDINARY [PART II—SEC. 3(ii)]
16.2 रसायन और रीििें तयै ारी
(क) मायो इनोजसिोल (सीएएस न.ं 87-89-8)
(ख) एसीिोजनराइल (सीएएस नं. 75-05-8)
(ग) अल्रा प्योर िािर
(घ) मायो इनोजसिोल स्ट्िैन्द्डड वस्ट्िॉक की तैयारी: 10 जम.ली. िॉल्यमू ेररक फ्लास्ट्क में लगभग 50 जम.ग्रा. इनोजसिोल
स्ट्िैन्द्डडव का ििन करें और इस े10 जम.ली. पानी से डाइल्यूि करें तर्ा यह 5000 पीपीएम का स्ट्िॉक सॉल्यूिन
देता ह।ै
(ङ) मायो-इनोजसिोल इंिरमीजडएि मानक सॉल्यूिन: 2.0 जम.ली. स्ट्िॉक मानक को 10 जम.ली. पानी के सार्
डाइल्यूि करें और अच्छी तरह से जमलाएं। यह 1000 पीपीएम का इंिरमीजडएि मानक सॉल्यिू न दते ा ह।ै
(च) सैंपल सांरता के अनुसार रैजखकता बर्ंद ुतैयार करें िैसा कक सारणी म ेंजनर्दवष्ट ककया गया ह।ै
सारणी
क्र.स.ं रैजखकता स्ट्िॉक सॉल्यूिन उपयोग ककये िान े उपयोग ककये मानक सांरता
मानक की सांरता िाले स्ट्िॉक िाने िाले पानी (माइक्रो ग्राम
(पीपीएम) सॉल्यूिन की मात्रा की मात्रा /जम.ली.)
(जम.ली.) (जम.ली.)
(i) मानक 1 1000 पीपीएम 0.10 0.90 100
(ii) मानक 2 1000 पीपीएम 0.25 0.75 250
(iii) मानक 3 5000 पीपीएम 0.10 0.90 500
(iv) मानक 4 5000 पीपीएम 0.16 0.84 800
(v) मानक 5 5000 पीपीएम 0.20 0.80 1000
(छ) सैंपल तैयार करना:
(i) सैंपल लेन े से पहले प्रोडक्ि को अच्छी तरह जमलाए ंया जहलाए।ं
(ii) तरल प्रोडक््स के जलए, 50 जम.ली. िॉल्यूमेररक फ्लास्ट्क म ेंप्रोडक्ि का 0.5 स े5 ग्राम (± 10%) ििन सिीक
रूप से तौल ें और ििन को जनकितम 0.0001 ग्राम तक ररकॉड वकरें।
(iii) ऐसे पाउडर प्रोडक््स के जलए जिन्द्ह ेंपनु सांरचना की आिश्यकता नहीं होती, 50 जम.ली. िॉल्यमू ेररक फ्लास्ट्क
में 0.25 से 2.0 ग्राम पाउडर का सिीक ििन ल ेंऔर ििन को जनकितम 0.0001 ग्राम तक ररकॉडव करें।
(iv) िॉल्यूमेररक में लगभग 10 से 15 जम.ली. पानी जमलाएँ और पाउडर को पूरी तरह से घुलने के जलए घुमाए ँ
या जहलाएँ। ऐसे पाउडर प्रोडक््स के जलए िो सर्-ग्राम स्ट्तर पर सिातीय नहीं ह,ैं प्रोडक््स लेर्ल जनदेिों
का पालन करत ेहुए पनु गवरठत करें और 50 जम.ली. िॉल्यूमेररक फ्लास्ट्क म ें0.5 स े5 ग्राम पुनगवरठत प्रोडक््स
का सिीक ििन करें। ििन को जनकितम 0.0001 ग्राम तक ररकॉडव करें।
(v) पानी के सार् मात्रा 50 जम.ली. तक र्नायें।
(vi) इसे 30 जमनि तक सोजनकेि करें और 0.22 माइक्रोन जसररंि कफल्िर स ेछान लें।
16.3 प्रकक्रया
एचपीएलसी जिश्लिे ण: उपकरण प्रचालन जस्ट्र्जतयों और इएलएसडी सेरिंग्स के जलए जनम्न सारणी का अनुसरण करें।
सारणी (एचपीएलसी जस्ट्र्जत)
(i) कॉलम एजमनो (250 जममी x 4.6 जममी); 5 माइक्रोन (कण
आकार)
(ii) जडिेक्िर एिेपोररिि लाइि स्ट्केिररंग जडिेक्िर (इएलएसडी)
(iii) जडिेक्िर तापमान 50o सेजल्सयस
(iv) ईएलएसडी गेन 6[भाग II—खण्ड 3(ii)] भारत का रािपत्र : असाधारण 21
(v) इएलएसडी चैम्र्र तापमान 40 o सेजल्सयस
(vi) नेर्ुलाइिर में नाइरोिन का 2.9 र्ार
दर्ाि
(vii) प्रिाह दर 2 जम. ली./जमनि
(viii) कॉलम तापमान 25o सेजल्सयस.
(ix) मोर्ाइल फेज़ ए- एसीिोजनराइल (80%)
र्ी- पानी (20%)
(x) रन िाइम 20 जमनि
(xi) इंिेक्िन मात्रा 5माइक्रो लीिर
16.4 गणना:
सैंपल क्षेत्र x मानक सांरता x डाइल्यूिन
मायो इनोजसिोल (जम.ग्रा./ककग्रा)=
मानक क्षेत्र x सैंपल ििन
16.5 सदं भ व
पाज़ौरेक ि.े 2014. हाइड्रोकफजलक जलकक्वड क्रोमैिोग्राफी द्वारा मुि मायो-इनोजसिोल का तीव्र पृर्क्करण और
जनधावरण। कार्ोहाइड्रेि ररसच.व 391: 55-60.
17. जििाजमन-C (एस्ट्कॉर्र्कव एजसड) का अिधारण
17.1 उपकरण
(क) कॉलम के सार् एचपीएलसी, कॉलम सी 18 (250 जममी x 4.6 जममी); 5माइक्रोन(कण आकार)
(ख) यूिी जडिेक्िर
(ग) एनाजलरिकल र्लै ेंस
(घ) 0.22माइक्रोन जसररंि कफल्िर
17.2 रसायन और रीििें तयै ारी
(क) एस्ट्कॉर्र्वक एजसड
(ख) 20mM मोनोर्ेजसक फॉस्ट्फेि र्फर: 1लीिर िॉल्यूमेररक फ्लास्ट्क में लगभग 800जम.ली. जडजस्ट्िल्ड िल में 2.76
ग्राम सोजडयम डाइहाइड्रोिन फॉस्ट्फेि (NaH PO ) घोल,ें ऑर्ोफॉस्ट्फोररक एजसड का उपयोग करके को 8.5
2 4
पीएच पर समायोजित करें, और अतं म ेंजडजस्ट्िल्ड िल के सार् 01 लीिर के जनिान तक डाइल्यूि करें।
(ग) ऑर्ो फॉस्ट्फोररक एजसड
(घ) मेर्नॉल
(ङ) एसीिोजनराइल
(च) मेर्नॉल: एसीिोजनराइल (60:40)
(छ) अजतिुद्ध िल
(ि) एस्ट्कॉर्र्वक एजसड स्ट्िॉक मानक सॉल्यूिन: 10 जम.ली. िॉल्यूमेररक फ्लास्ट्क में लगभग 10 जम.ग्रा. एस्ट्कॉर्र्वक एजसड
मानक ििन करें और इस े 10 जम.ली. मोर्ाइल फेि के सार् डाइल्युि करें, यह 1000 जम.ग्रा./जम.ली. का स्ट्िॉक
सॉल्यूिन दते ा ह।ै
(झ) एस्ट्कॉर्र्वक एजसड इंिरजमजडएि मानक सॉल्यूिन: 1.0 जम.ली. स्ट्िॉक मानक को मोर्ाइल फेि के सार् 10 जम.ली.
तक डाइल्यूि करें, और अच्छी तरह स ेजमलाएं, यह 100 पीपीएम का इंिरजमजडएि मानक सॉल्यूिन देता ह।ै इस
मानक सॉल्यूिन स,े मोर्ाइल फेि के सार् 1.0 जम.ली. इंिरजमजडएि मानक सॉल्यूिन को 10 जम.ली. तक डाइल्युि
करें। यह 10 पीपीएम का इंिरजमजडएि मानक सॉल्यिू न देता ह।ै
(ञ) सैंपल सांरता के अनुसार जनम्न सारणी म ें िर्णवत जनर्दवष्ट के अनसु ार रैजखकता बर्ंद ुतैयार करें।22 THE GAZETTE OF INDIA : EXTRAORDINARY [PART II—SEC. 3(ii)]
सारणी
क्र.स.ं रैजखकता स्ट्िॉक सॉल्यूिन की उपयोग ककये उपयोग ककये मानक सांरता
मानक सांरता (पीपीएम) िाने िाले िाने िाले (जम.ग्रा./जम.ली.)
स्ट्िॉक पानी की
सॉल्यूिन की मात्रा
मात्रा (जम.ली.) (जम.ली.)
(i) मानक 1 10 पीपीएम 0.10 0.90 1
(ii) मानक 2 10 पीपीएम 0.20 0.80 2
(iii) मानक 3 100 पीपीएम 0.05 0.95 5
(iv) मानक 4 1000 पीपीएम 0.10 0.90 10
(v) मानक 5 1000 पीपीएम 0.05 0.95 50
(vi) मानक 6 1000 पीपीएम 0.10 0.90 100
(ि) सैंपल तैयार करना
(i) पररक्षण सैंपल लने े स ेपहल े प्रोडक््स को अच्छी तरह जमलाए ंया जहलाएं।
(ii) तरल प्रोडक््स के जलए, 50 जम.ली. िॉल्यूमेररक फ्लास्ट्क म ेंनमनू े का 0.5 से 5 ग्राम (± 10%) ििन सिीक
रूप से तौल ें और ििन को जनकितम 0.0001 ग्राम तक ररकॉड वकरें।
(iii) ऐसे पाउडर उत्पाद के जलए जिन्द्ह ेंपुनसांरचना की आिश्यकता नहीं होती, 50 जम.ली. िॉल्यूमेररक फ्लास्ट्क
में 1.0 ग्राम पाउडर का सही ििन करें और ििन को जनकितम 0.0001 ग्राम तक ररकॉडव करें।
(iv) 50 जम. ली. िॉल्यूमेररक फ्लास्ट्क में लगभग 10 स े 15 जम. ली. मोर्ाइल फेज़ डाल ें और पाउडर को परू ी
तरह से घलु न े के जलए घुमाएँ या जहलाएँ। ऐसे पाउडर प्रोडक््स के जलए िो सर्ग्राम स्ट्तर पर सिातीय
नहीं ह,ैं प्रोडक््स लेर्ल जनदेिों का पालन करत े हुए पुनगवरठत करें और 50 जम. ली. िॉल्यूमेररक फ्लास्ट्क
में 1.0 ग्राम पुनगवरठत प्रोडक््स का सिीक ििन करें। ििन को जनकितम 0.0001 ग्राम तक ररकॉडव करें।
(v) मोर्ाइल फेि से मात्रा 50 जम.ली. तक र्नायें।
(vi) इस े 30 जमनि तक सोजनकेि करें और 0.22माइक्रोन जसररंि कफल्िर स ेछान लें।
(vii) जिश्लेिण के जलए एचपीएलसी-यूिी म ें 5 माइक्रो लीिर इंिेक्ि करें।
17.3 प्रकक्रया
(i) एचपीएलसी जिश्लेिण: उपकरण प्रचालन जस्ट्र्जतयों के जलए सारणी देख ें
सारणी (एचपीएलसी जस्ट्र्जत)
(i) कॉलम सी18 (250 जममी x 4.6 जममी); 5माइक्रोन (कण आकार)
(ii) जडिेक्िर यूिी
(iii) िेिलेंर् 230 एन एम
(iv) प्रिाह दर 1.0 जम. ली./जमनि
(v) कॉलम तापमान 20 जडग्री सेजल्सयस
(vi) मोर्ाइल फेज़ क - पानी में 20 mM मोनोर्ेजसक फॉस्ट्फेि र्फर, ऑर्ो
फॉस्ट्फोररक एजसड के सार् पीएच को 2.5 पर समायोजित करें
ख - मर्े नॉल: एसीिोजनराइल (60:40)
(vii) रन िाइम 8 जमनि
(viii) इंिेक् िन की मात्रा 5 माइक्रो लीिर[भाग II—खण्ड 3(ii)] भारत का रािपत्र : असाधारण 23
सारणी (ग्रजे डएंि)
क्र.स.ं समय % ख
(i) 0 5
(ii) 2.0 5
(iii) 2.1 25
(iv) 13.0 25
(v) 13.1 90
(vi) 18.0 90
(vii) 18.1 5
(viii) 25.0 5
17.4 गणना-
सैंपल क्षेत्र x मानक सांरता x डाइल्यूिन
जििाजमन सी (जम.ग्रा./ककलोग्राम)=
मानक क्षेत्र x सैंपल ििन
17.5 सदं भ-व
लेिे़ि एस एस 2011. संतरे के रस म ें एस्ट्कॉर्र्वक एजसड, साइररक एजसड और र्ेंिोइक एजसड का जिश्लेिण। एजिलिें
एप्लीकेिन सॉल्यिू न। एजिलेंि िेक्नोलॉिीि; यूएसए में प्रकाजित, 01 जसतंर्र, 2011।
18. िोकोफेरॉल (जििाजमन ई) का अिधारण
18.1 उपकरण
(क) कॉलम के सार् एचपीएलसी, कॉलम सी18 (150 जममी x 4.6 जममी); 5 माइक्रोन (कण आकार)
(ख) यूिी जडिेक्िर
(ग) एनाजलरिकल र्लै ेंस
(घ) 0.22 माइक्रोन जसररंि कफल्िर
18.2 रसायन और रीििें तयै ारी
(क) िोको़िेरॉल (सीएएस नं. 10191-4-0)
(ख) एसीिोजनराइल (सीएएस न.ं 75-05-8)
(ग) मेर्नॉल (सीएएस न ं 67- 56-1)
(घ) मेर्नॉल: पानी (98:2): 98 जम. ली. मेर्नॉल को 2 जम. ली. पानी में जमलाए ं
(ङ) िोकोफेरॉल (जििाजमन ई) स्ट्िॉक मानक सॉल्यूिन: 50 जम.ली. िॉल्यूमेररक फ्लास्ट्क में लगभग 50 जम.ग्रा. िोकोफेरॉल
मानक ििन करें और इसे 50 जम.ली. मेर्नॉल के सार् डाइल्यूि करें और यह 1000 पीपीएम का स्ट्िॉक सॉल्यूिन
देता ह।ै
(च) िोको़िेरॉल इंिरजमजडएि मानक सॉल्यूिन: 1.0 जम.ली. स्ट्िॉक मानक को मर्े नॉल के सार् 10 जम.ली. तक डाइल्यूि
करें और अच्छी तरह से जमलाए।ँ यह 100 पीपीएम का इंिरजमजडयि मानक सॉल्यूिन देता ह।ै इस मानक सॉल्यूिन
से, इंिरजमजडएि मानक सॉल्यूिन के 1.0 जम.ली. को मर्े नॉल के सार् 10 जम.ली. तक डाइल्यिू करें, यह 10 पीपीएम
का इंिरजमजडयि मानक सॉल्यिू न दते ा ह।ै
(छ) नीचे सारणी म ेंजिजनर्दवष्ट सैंपल सांरता के अनुसार रैजखकता बर्ंद ुतैयार करें24 THE GAZETTE OF INDIA : EXTRAORDINARY [PART II—SEC. 3(ii)]
सारणी
क्र.स रैजखकता स्ट्िॉक सॉल्यूिन उपयोग ककये उपयोग ककये मानक सांरता
मानक की सांरता िाने िाले िाने िाले (जम.ग्रा./जम.ली.)
(पीपीएम) स्ट्िॉक पानी की मात्रा
सॉल्यूिन की (जम.ली.)
मात्रा (जम.ली.)
(i) मानक 1 10 पीपीएम 0.10 0.90 1
(ii) मानक 2 10 पीपीएम 0.20 0.80 2
(iii) मानक 3 100 पीपीएम 0.05 0.95 5
(iv) मानक 4 1000 पीपीएम 0.10 0.90 10
(v) मानक 5 1000 पीपीएम 0.05 0.95 50
(vi) मानक 6 1000 पीपीएम 0.10 0.90 100
(ि) सपैं ल तयै ार करना
(i) सैंपल लेन े से पहले नमून े को अच्छी तरह जमलाएं या जहलाएं।
(ii) तरल नमून ेके जलए, 50 जम.ग्रा. नमून ेको 50 जम.ली. िॉल्यूमेररक फ्लास्ट्क म ेंसिीक रूप स ेतौल ेंऔर ििन को
जनकितम 0.0001 ग्राम तक ररकॉडव करें।
(iii) ऐसे पाउडर नमनू े के जलए जिन्द्ह ें पुनसांरचना की आिश्यकता नहीं होती, 50 जम.ली. िॉल्यूमरे रक फ्लास्ट्क म ें
1.0 ग्राम पाउडर का सही ििन करें और ििन को जनकितम 0.0001 ग्राम तक ररकॉड वकरें।
(iv) 50 जम. ली. िॉल्यूमेररक फ्लास्ट्क म ें लगभग 10 स े 15 जम. ली. मर्े नॉल डाल ें और पाउडर को पूरी तरह स े
घुलन े के जलए घुमाएँ या जहलाएँ। पाउडर िाल े नमून े के जलए िो सर्-ग्राम स्ट्तर पर सिातीय नहीं ह,ैं उत्पाद
लेर्ल जनदेिों का पालन करत े हुए पुनगवरठत करें और 50 जम. ली. िॉल्यूमेररक फ्लास्ट्क म ें 1.0 ग्राम पुनगवरठत
नमूने का सिीक ििन करें। ििन को जनकितम 0.0001 ग्राम तक ररकॉड वकरें।
(v) मेर्नॉल के सार् मात्रा को 50 जम.ली. तक र्ढ़ाएं।
(vi) इसे 0.22 माइक्रोन जसररंि कफल्िर से छान लें।
18.3 प्रकक्रया
(क) एचपीएलसी जिश्लेिण: उपकरण प्रचालन जस्ट्र्जतयों के जलए सारणी देख ें
सारणी (एचपीएलसी जस्ट्र्जत)
(i) कॉलम सी 18 (150जममी x 4.6 जममी);5 माइक्रोन (कण आकार)
(ii) जडिेक्िर यूिी
(iii) जडिेबक्िंग िेिलर्ें 292 एन एम
(iv) प्रिाह दर 1.0 जम. ली./जमनि
(v) कॉलम तापमान 25 जडग्री सजे ल्सयस
(vi) मोर्ाइल फेज़ 98% मर्े नॉल: 2% पानी
(vii) रन िाइम 20 जमनि
(viii) अनुमाजनत ररिेंिन समय 10- 15 जमनि
(ix) इंिेक्िन की मात्रा 20 माइक्रो लीिर
गणना:
सपैं ल क्षेत्र x मानक सांरता x डाइल्यूिन
जििाजमन ई (जम.ग्रा./ककलोग्राम)=
मानक क्षेत्र x सैंपल ििन[भाग II—खण्ड 3(ii)] भारत का रािपत्र : असाधारण 25
18.4 सदं भ-व
िैर्कोिा आई , कोिारोिा एल , सैरिंस्ट्की डी , हिजलकोिा एल और सोजलच पी 2013, मोनोजलजर्क कॉलम का
उपयोग करके आहार सपलीमेंि म ेंजििाजमन ई एसीिेि के जनधावरण के जलए फास्ट्ि एचपीएलसी जिजध। खाद्य जिश्लेिण
पद्यजतयाँ 6:380-385.
19. र्ायजमन हाइड्रोक्लोराइड (जििाजमन र्ी1) का अिधारण
19.1 उपकरण
(क) ररिसव फेज़ एल सी -18 कॉलम (250 जममी × 4.6 जममी), 5 माइक्रोन कण आकार
(ख) यिू ी जडिेक्िर
(ग) एनाजलरिकल र्लै ेंस
(घ) सोजनकेिर
(ङ) िैक्यूम कफल्िर असेंर्ली
(च) 0.22 माइक्रोन जसररंि कफल्िर
(छ) माइक्रो जपपेि
19.2 रसायन और रीििें तयै ारी
(क) पेन्द्िेन सल्फोजनक एजसड
(ख) ग्लेजियल एसीिीक एजसड
(ग) जडजस्ट्िल्ड िल
(घ) राइएजर्लमाइन
(ङ) मेर्नॉल (सीएएस संख्या 67- 56-1)
(च) र्ायजमन हाइड्रोक्लोराइड
(छ) मोर्ाइल फेज़ :
(i) 1.8 ग्राम पेंिेन सल्फोजनक एजसड, 5 जम. ली. ग्लेजियल एजसरिक एजसड, 0.9 जम. ली. राइएजर्ल एमाइन और
265 जम. ली. मेर्नॉल जमलाएं। जडजस्ट्िल्ड िल के सार् मात्रा को 1000 जम. ली. तक र्नाएँ।
(ii) इस े 45 जमनि तक सोजनकेि करें तर्ा उपयोग स े पहल े र्फर को िैक्यूम कफल्िर करें और डी-गैस करें।
(ि) र्ायजमन हाइड्रोक्लोराइड स्ट्िॉक मानक सॉल्यूिन: 10 जम.ली. िॉल्यूमेररक फ्लास्ट्क म ेंलगभग 10 जम.ग्रा. मानक ििन
करें, इस ेगम वकरके 1.0- 1.5 जम. ली. एजसरिक एजसड म ेंघोल,ें जडजस्ट्िल्ड िल के सार् मात्रा को 10 जम. ली. तक र्ढ़ाए,ँ
यह 1000 पीपीएम का स्ट्िॉक सॉल्यूिन दते ा ह।ै
(झ) र्ायजमन हाइड्रोक्लोराइड इंिरजमजडएि मानक सॉल्यूिन: 1.0 जम.ली. स्ट्िॉक मानक को जडजस्ट्िल्ड िल के सार् 10
जम.ली. तक डाइल्यूि करें और अच्छी तरह स े जमलाएं। यह 100 पीपीएम का इंिरजमजडएि मानक सॉल्यूिन देता ह।ै
जडजस्ट्िल्ड िल के सार् 1.0 जम.ली. इंिरजमजडएि मानक सॉल्यिू न को 10 जम.ली. तक डाइल्यिू करें। यह 10 पीपीएम
का इंिरजमजडएि मानक सॉल्यिू न दते ा ह।ै
(ञ) सैंपल सांरता के अनुसार जनम्न सारणी म ें िर्णवत जनर्दवष्ट के अनसु ार रैजखकता बर्ंद ुतैयार करें।
सारणी
क्र.स.ं रैजखकता स्ट्िॉक सॉल्यूिन की उपयोग ककये उपयोग ककये मानक सांरता
मानक सांरता (पीपीएम) िाने िाले स्ट्िॉक िाने िाले (जम.ग्रा./जम.ली.)
सॉल्यूिन की पानी की मात्रा
मात्रा (जम.ली.) (जम.ली.)
(i) मानक 1 10 पीपीएम 0.10 0.90 1
(ii) मानक 2 10 पीपीएम 0.20 0.80 2
(iii) मानक 3 100 पीपीएम 0.05 0.95 526 THE GAZETTE OF INDIA : EXTRAORDINARY [PART II—SEC. 3(ii)]
(iv) मानक 4 1000 पीपीएम 0.10 0.90 10
(v) मानक 5 1000 पीपीएम 0.05 0.95 50
(vi) मानक 6 1000 पीपीएम 0.10 0.90 100
(ि) सपैं ल तयै ार करना
(i) जिश्लेिण स ेपहल े नमून े को अच्छी तरह जमलाए ं या जहलाएं।
(ii) तरल नमनू े के जलए, 50 जम.ली. िॉल्यूमेररक फ्लास्ट्क म ें नमनू े का 0.5 स े 5 ग्राम (± 10%) ििन सिीक रूप स े
तौलें और ििन को जनकितम 0.0001 ग्राम तक ररकॉड व करें।
(iii) ऐसे पाउडर नमून े के जलए जिन्द्ह ें पुनसांरचना की आिश्यकता नहीं होती, 50 जम.ली. िॉल्यूमरे रक फ्लास्ट्क म ें 1.0
ग्राम पाउडर का सही ििन करें और ििन को जनकितम 0.0001 ग्राम तक ररकॉड व करें।
(iv) 50 जम. ली. िॉल्यूमेररक फ्लास्ट्क म ें लगभग 10 स े 15 जम. ली. मोर्ाइल फेज़ डालें और पाउडर को पूरी तरह स े
घुलन े के जलए घुमाएँ या जहलाएँ। ऐस े पाउडर नमनू े के जलए िो सर् ग्राम स्ट्तर पर सिातीय नहीं ह,ैं नमनू े लेर्ल
जनदेिों का पालन करत े हुए पनु गवरठत करें और 50 जम. ली. िॉल्यूमेररक फ्लास्ट्क म ें 1.0 ग्राम पुनगवरठत नमून े का
सिीक ििन करें। ििन को जनकितम 0.0001 ग्राम तक ररकॉडव करें।
(v) मोर्ाइल फेि के सार् मात्रा 50 जम.ली. तक र्नायें।
(vi) इस े 30 जमनि तक सोजनकेि करें और 0.22 माइक्रोन जसररंि कफल्िर स ेछान लें।
19.3 प्रकक्रया
(i) जिश्लेिण के जलए एचपीएलसी- यूिी जडिेक्िर म ेंमानक या नमनू े के 20 माइक्रो लीिर को इंिक्े ि करें।
(ii) क्रोमैिोग्राकफक जस्ट्र्जतयां
(क) ररिसव फेि सी 18 कॉलम )250 जममी x 4.6 जममी x 5 माइक्रोन) का उपयोग करें
(ख) आइसोक्रेरिक एल्यूिन के जलए 1000 जम. ली. तक िॉल्यूम र्नाने के जलए 1.8 ग्राम पेंिेन सल्फोजनक एजसड, 5
जम. ली. ग्लेजियल एजसरिक एजसड, 0.9 जम. ली. राइएजर्लमाइन और 265 जम. ली. मेर्नॉल और पानी स ेयुि
मोर्ाइल फेि का उपयोग करें।
(ग) 1 जम. ली. प्रजत जमनि की प्रिाह दर पर 22o सेजल्सयस पर कॉलम को जस्ट्र्र करें। कॉलम को कंडीिन करन े
के जलए मर्े नॉल का उपयोग करें।
(घ) 0.22 माइक्रोन जझल्ली कफल्िर के माध्यम स ेिैक्यूम के तहत मोर्ाइल फेि को क़िल्िर करें और उपयोग स ेपहल े
इसे डीगैस करें।
(ङ) एचपीएलसी के इंिेक्िर म ेंइंिक्े िन के जलए 20 माइक्रो लीिर का उपयोग करें।
(iii) एचपीएलसी जिश्लेिण : उपकरण पररचालन के जलए जनम्न सारणी म ें िर्णतव जस्ट्र्जतयों का अनपु ालन करें
सारणी (एचपीएलसी जस्ट्र्जत)
(i) क ॉलम सी18 (250 जममी x 4.6 जममी); 5 माइक्रोन (कण आकार)
(ii) ज डिेक्िर यूिी
(iii) ि ेिलेंर् 230 एन एम
(iv) प्र िाह दर 1.0 जम.ली./जमनि
(v) क ॉलम तापमान 40o सेजल्सयस
(vi) म ोर्ाइल फेि मोर्ाइल फेि के सार् आइसोक्रेरिक इलुिन जिसम ें 1.8 ग्राम पेंिेन
सल्फोजनक एजसड, 5 जम. ली. ग्लेजियल एजसरिक एजसड, 0.9 जम.
ली. राइएजर्ल एमाइन और 265 जम. ली. मेर्नॉल िाजमल ह।ै
जडसरिल्ड िल के सार् मात्रा को 1000 जम. ली. तक र्ढ़ाए ँ
(vii) र न िाइम 8 जमनि
(viii) इ ंिेक्िन िॉल्यूम 20 माइक्रो लीिर[भाग II—खण्ड 3(ii)] भारत का रािपत्र : असाधारण 27
19.4 गणना:
नमूना क्षेत्र x मानक सांरता xतनुकरण
जििाजमन B1 (जम.ग्रा. / ककग्रा)
मानक क्षेत्र x नमूना भार
19.5 सदं भ व
मासवज़ाल एम एल., लेजर्डेबज़ंस्ट्का ए. ज़ारनोव्स्ट्क. डब्लल ू और िे़िर पी . 2005. कोलोमेररक इलक्े रोकेजमकल और
परार्ैंगनी पहचान का उपयोग करके फामावस्ट्युरिकल ़िॉमलूव ेिन में र्ायजमन हाइड्रोक्लोराइड, पाइररडोजक्सन
हाइड्रोक्लोराइड और साइनोकोर्ालाजमन के एक सार् जनधावरण के जलए उच्च-प्रदिवन तरल क्रोमैिोग्रा़िी जिजध, िनलव
ऑ़ि क्रोमैिोग्रा़िी, 1094: 91–98.
20. साइररक एजसड का अिधारण
क्रम संख्या 16 में िर्णवत एस्ट्कॉर्र्वक एजसड के अिधारण के जलए प्रयिु जिजध का उपयोग, मानक तैयारी को
छोड़कर साइररक एजसड के अिधारण के जलए ककया िा सकता है, मानक तैयारी इस प्रकार ह:ै
(i) साइररक एजसड स्ट्िॉक मानक जिलयन :10 जम.ली. िॉल्यूमेररक फ्लास्ट्क म ें लगभग 10 जम.ग्रा. साइररक एजसड
मानक ििन करें और इसे 10 जम.ली. मोर्ाइल फेि के सार् डाइल्युि करें, यह 1000 पीपीएम का स्ट्िॉक जिलयन
देता ह।ै
(ii) नमूना सांरता के अनुसार जनम्न सारणी में कदए गए जििरण के अनुसार रैजखकता बर्ंद ुतैयार करें।
सारणी
क्र.स.ं रैजखकता मानक स्ट्िॉक साल्यूिन की उपयोग ककये उपयोग ककये मानक
सांरता (पीपीएम) िाने िाले िाने िाले पानी सांरता
स्ट्िॉक घोल की की मात्रा (माइक्रो ग्राम
मात्रा (जम.ली.) (जम.ली.) /जम.ली.)
(i) मानक 1 1000 पीपीएम 1.000 0.000 1000
(ii) मानक 2 1000 पीपीएम 0.750 0.250 750
(iii) मानक 3 1000 पीपीएम 0.500 0.500 500
(iv) मानक 4 1000 पीपीएम 0.250 0.750 250
(v) मानक 5 1000 पीपीएम 0.125 0.875 125
(vi) मानक 6 1000 पीपीएम 0.100 0.900 100
सदं भ-व
कोपोला ई डी और स्ट्िार एम एस 1986. एप्पल िूस और क्रैनर्ेरी िूस के कॉकिेल म ेंप्रमुख आगेजनक एजसड का जलकक्वड
क्रोमैिोग्राकफक जनधावरण : सहयोगी अध्ययन एसोजसएि ऑ़ि. एनाल. केम. िे . 69: 594- 597.
21. α-एमाइलिे गजतजिजध का अिधारण
यह अिधारण 30 ± 0.1o सेजल्सयस पर स्ट्िाचव घोल के हाइड्रोजलजसस की मानक जडग्री प्राप्त करन े के जलए लगन े िाल े
आिश्यक समय पर आधाररत ह ै और हाइड्रोजलजसस की जडग्री हाइड्रोलाइज़ेि के आयोडीन रंग की तलु ना मानक रंग स े
करके जनधावररत की िाती ह।ै
21.1 उपकरण
(क) स्ट्पेक्रोफोिोमीिर
(ख) एनाजलरिकल र्लै ेंस
(ग) फ्यूम हुड
21.2 रसायन और रीििें तयै ारी
(क) कोर्ाल्िस क्लोराइड
(ख) पोिेजियम डाइक्रोमेि
(ग) हाइड्रोक्लोररक एजसड28 THE GAZETTE OF INDIA : EXTRAORDINARY [PART II—SEC. 3(ii)]
(घ) पोिेजियम डाइहाइड्रोिन फॉस्ट्फेि (KH PO )
2 4
(ङ) जडर्ेजसक सोजडयम फॉस्ट्फेि(Na HPO )
2 4
(च) आयोडीन
(छ) पोिेजियम आयोडाइड
(ि) एंिाइम α-एमाइलेि
(झ) संदभव रंग मानक :0.01 एन हाइड्रोक्लोररक एजसड के 100 जम. ली. में 25.0 ग्राम कोर्ाल्िस क्लोराइड
)CoCl 6H O) और 3.84 ग्राम पोिेजियम डाइक्रोमेि को घोलकर एक रंग मानक तैयार करें तर्ा एम्र्र रंग की
2 2
स्ट्िॉपर िाली र्ोतल में सग्रं हीत होने पर यह मानक अजनजश्चत काल तक जस्ट्र्र रहता ह।ै
(ञ) फॉस्ट्फेि र्फर पी एच 6.6:
(i) सल्यूिन ए: 1000 जम. ली. र्नाने के जलए पयावप्त पानी म ें 9.1 ग्राम पोिेजियम डाइहाइड्रोिन फॉस्ट्फेि
(KH PO ) घोलें।
2 4
(ii) सल्यूिन र्ी :1000 जमली लीिर र्नान े के जलए पयावप्त पानी में 9.5 ग्राम जडर्ेजसक सोजडयम फॉस्ट्फेि
(Na HPO ) घोलें।
2 4
(iii) 600 जमली लीिर सल्यूिन र्ी में 400 जमली लीिर सल्यूिन ए जमलाएं, और यकद आिश्यक हो तो सल्यूिन
ए या सल्यूिन र्ी को आिश्यकतानुसार जमलाकर पीएच को पी एच 6.6 पर समायोजित करें।
(ि) स्ट्िॉक आयोडीन घोल: लगभग 200 जमली लीिर पानी म ें 5.5 ग्राम आयोडीन और 11.0 ग्राम पोिेजियम आयोडाइड
घोलें, पानी स े250 जमली लीिर तक डाइल्युि करें और जमलाएँ, एक गहरे रंग की र्ोतल में स्ट्िोर करें और हर 30 कदन
में एक नया घोल र्नाएँ।
(ठ) तनु आयोडीन घोल :300 जमली लीिर जडसरिल्ड िल म ें 20 ग्राम पोिेजियम आयोडाइड घोलें और 2.0 जमली लीिर
स्ट्िॉक आयोडीन घोल डालें, जमिण को 500 जमली लीिर िॉल्यूमेररक फ्लास्ट्क म ें डालें, पानी के सार् मात्रा के अनुसार
डाइल्युि करें और जमलाए ँ और प्रजतकदन तैयार करें।
(ड) स्ट्िाच वसब्लसरेि घोल :100 जमली ठंड ेपानी म ें10.0 ग्राम (सूखे ििन के आधार पर) स्ट्िाचव को घोल ेंऔर धीरे-धीरे जमिण
को 300 जमली उर्लत े पानी म ें डाल,ें 1 स े 2 जमनि तक उर्ालें और जहलाए,ं और कफर लगातार जहलाते हुए ठंडा करें।
पानी की सहायता स े जमिण को 500 जमली िॉल्यूमेररक फ्लास्ट्क म ें डाल,ें 10 जम.ली. फॉस्ट्फेि र्फर पीएच 6.6 डाल,ें
पानी के सार् मात्रा म ेंतन ु करें और जमलाएँ।
(ढ) एिं ाइम तनुकरण: एक एंिाइम सल्यूिन तैयार करें ताकक अंजतम तनुकरण का 10 जम.ली. अिधारण जस्ट्र्जतयों के अधीन
15-35 के र्ीच अंजतम बर्ंद ुद ें ।
21.3 प्रकक्रया
(क) 5.0 जम. ली. तन ु आयोडीन घोल को कांच की िेस्ट्ि ट्यूर्ों की एक िृंखला म ें जपपेि करें और उन्द्ह ें 30 ± 0.1 o
सेजल्सयस पर जस्ट्र्र ककये गए िािर र्ार् म ेंरखें।
(ख) 50 जम.ली. एलने मेयर फ्लास्ट्क में स्ट्िाचव सब्लसरेि घोल के 20.0 जम. ली. जपपेि करें, स्ट्िॉपर लगाय ेंऔर 30 ± 0.1 o
सेजल्सयस पर िािर र्ार् म ें 20 जमनि के जलए स्ट्र्ाजपत करें।
(ग) िून्द्य समय पर, तेिी से सतं ुजलत सब्लसरेि में तैयार नमूना के 5.0 जम. ली. जपपेि करें, घुमाकर तरु ंत जमलाए,ं फ्लास्ट्क
को स्ट्िॉपर करें और इसे िापस िािर र्ार् में रखें।
(घ) 10 जमनि के र्ाद, 50 जम. ली. फ्लास्ट्क से प्रजतकक्रया जमिण के 1.0 जम. ली. को तनु आयोडीन घोल िाली िेस्ट्ि ट्यूर्
में से एक म ेंस्ट्र्ानांतररत करें, ट्यूर् को जहलाएं।
(ङ) घोल को जमलाए ंऔर जडसरिल्ड िल के सापेक्ष 660 एन एम पर संदभव रंग के ओडी के सार् इसके ओडी की तलु ना
करें और िर् प्रजतकक्रया अंत बर्दं ुके करीर् पहुचं ती ह,ै तो संदभ व रंग मानक ओडी के सार् तलु ना के जलए एक जमनि
के जनयजमत अंतराल पर एक एजलक्वॉि जलया िाना चाजहए और अंत बर्ंद ु की गणना जनकाले गए दो एजलक्वॉि के
ओडी मल्ू यों पर जिचार करके की िाती ह ै(प्रजतकक्रया अंत बर्ंद ुके करीर् पहुचं न े पर 2 जमनि का अंतर);
(च) जिसमें 660 एन एम पर एक एजलक्वॉि का ओडी संदभ व रंग ओडी से अजधक ह ै और दसू रे का ओडी ओडी संदभ व
रंग ओडी से कम ह.ै
रिप्पण: प्रजतकक्रया समय को अजंतम बर्ंद ुपर ककया िाता ह ैऔर सुजनजश्चत ककया िाता ह ैकक जपपेि रिप आयोडीन
जिलयन को न छुए, क्योंकक हाइड्रोलाइबिंग जमिण म ेंआयोडीन का िापस िाना एंिाइम कक्रया में र्ाधा उत्पन्न
करेगा और जनधावरण के पररणामों को प्रभाजित करेगा।[भाग II—खण्ड 3(ii)] भारत का रािपत्र : असाधारण 29
21.4 गणना:
(i) एक एमाइलेि यूजनि (एय ू ) को एंिाइम की उस मात्रा के रूप म ें पररभाजित ककया िाता ह ै िो जनर्दवष्ट परीक्षण
जस्ट्र्जतयों के तहत 1 जम.ग्रा./जमनि की दर स ेस्ट्िाचव को डक्े सररनाइि करेगा।
(ii) नमूने की α-एमाइलेि गजतजिजध की गणना सूत्र द्वारा करें, जिसे एयू के रूप म ेंव्यि ककया िाता ह:ै
एयू /ग्राम = (40 x एफ )/ िी
िहा,ं
40, एक कारक (400/10) ह ैिो 400 जम.ग्रा. स्ट्िाच व(2% घोल के 20 जम. ली.) और उपयोग ककए गए नमनू े
के 10 जम. ली. एजलक्वॉि से प्राप्त होता ह ै
एफ, तनुकरण कारक ह ै(कुल तनुकरण मात्रा/नमूना भार, ग्राम में) और
िी, जमनिों में डेक्सररनाइबिंग समय ह ैऔर इसकी गणना इस प्रकार की िाती ह ै
(उच्च परीक्षण ओडी - संदभव रंग मानक ओडी )/60
सेकंड में गणना (िी)=
(उच्च परीक्षण ओडी - जनम्न परीक्षण ओडी )/60
21.5 सदं भ:व
α-एमाइलेि गजतजिजध; एफएओ, िेइसीएफए मोनोग्राफ; खाद्य योिक जिजनदेिों का संयुि संग्रह; खाद्य योिकों पर
संयुि एफएओ/डब्ललूएचओ जििेिज्ञ सजमजत; खडं 4 जिश्लेिणात्मक जिजधयां, परीक्षण प्रकक्रयाएं और प्रयोगिाला
सल्यूिन जिनका उपयोग और संदभव खाद्य योिक जिजनदेिों म ेंककया गया ह,ै पष्ठृ 119-120. आईएसएसएन 1817-
7077.
22. प्रोिीएज़ गजतजिजध का अिधारण
इस प्रकक्रया का उपयोग प्रोिीि गजतजिजध को जनधावररत करन े के जलए ककया िाता ह,ै जिस े पीसी इकाइयों के रूप म ें व्यि
ककया िाता ह।ै अिधारण 37o सेजल्सयस और पीएच 7.0 पर कैसीन का 30 जमनि के प्रोरियोजलरिक हाइड्रोजलजसस पर
आधाररत ह।ै अनहाइड्रोलाइज्ड कैसीन को कफल्िरेिन द्वारा हिा कदया िाता ह,ै और घलु निील कैसीन को स्ट्पेक्रोफोिोमेररक
रूप से जनधावररत ककया िाता ह।ै
22.1 उपकरण:
(क) िािर र्ार्
(ख) स्ट्पेक्रोफोिोमीिर
(ग) पीएच मीिर
(घ) एनाजलरिकल र्लै ेंस
(ङ) स्ट्िचाजलत जपपेिस व
(च) िाइमर
(छ) चुंर्कीय जस्ट्िरर
22.2 रसायन और रेििें की तयै ारी
(क) ररस (हाइड्रॉक्सीमेजर्ल) एजमनोमेर्ेन
(ख) राइक्लोरोएसेरिक एजसड
(ग) सोजडयम एसीिेि राइहाइड्रेि
(घ) ग्लेजियल एजसरिक एजसड
(ङ) हाइड्रोक्लोररक एजसड
(च) कैजसन
(छ) प्रोिीि एंिाइम30 THE GAZETTE OF INDIA : EXTRAORDINARY [PART II—SEC. 3(ii)]
(ि) ररस र्फर (पी एच 7.0): 800 जम.ली. पानी म ें 12.1 ग्राम एिं ाइम-ग्रडे (या समतुल्य) ररस (हाइड्रॉक्सीमेजर्ल)
एजमनोमेर्ेन घोल,ें और 1N हाइड्रोक्लोररक एजसड के सार् पीएच 7.0 तक िाइरेि करें। 1,000-जम. ली. िॉल्यूमेररक
फ्लास्ट्क में डाल,ें मात्रा को पानी के सार् तन ुकरें, और जमलाएँ।
(झ) िीसीए घोल :1,000-जम. ली. िॉल्यूमेररक फ्लास्ट्क म ें 800 जम. ली. पानी म ें 18 ग्राम राइक्लोरोएसेरिक एजसड
और 19 ग्राम सोजडयम एसीिेि राइहाइड्रेि घोल,ें 20 जम. ली. ग्लेजियल एजसरिक एजसड डालें, मात्रा को पानी के
सार् तन ुकरें, और जमलाएँ।
(ञ) सब्लसरेि घोल: 500 जम. ली. पानी में 6.05 ग्राम ररस (हाइड्रॉक्सीमेजर्ल) एजमनोमर्े ेन (एंिाइम ग्रडे ) घोल,ें 8 जम.
ली. 1N हाइड्रोक्लोररक एजसड डाल ें और जमलाएँ, इस घोल म ें7 ग्राम कैसीन घोल ें और उर्लते िािर र्ार् म ें 30
जमनि तक गमव करें, र्ीच-र्ीच में जहलाते रह,ें कमरे के तापमान तक ठंडा करें और 0.2N हाइड्रोक्लोररक एजसड के
सार् पीएच 7.0 पर समायोजित करें, एजसड को धीरे-धीरे, तिे ी से जहलाते हुए डाल ें ताकक कैसीन का अिक्षेपण न
हो और जमिण को 1,000-जम.ली. िॉल्यूमेररक फ्लास्ट्क म ेंडालें, पानी के सार् मात्रा को तनु करें और जमलाएँ।
(ि) नमूना तैयार करना: ररस र्फर का उपयोग करके, नमूना एंिाइम का एक घोल तैयार करें ताकक अंजतम डायल्यूिन
के 2 जम.ली. में 10 और 44 पीसी इकाइयाँ हों।
(ठ) िायरोजसन मानक की तैयारी : 100 जम.ग्रा. िायरोजसन को, जिसे पहल े105o सेजल्सयस पर 1 घंिे के जलए सुखाया
गया हो, 1000 जम. ली. िॉल्यमू ेररक फ्लास्ट्क म ें डालें। 60 जम. ली. हाइड्रोक्लोररक एजसड म ें घोलें और जडसरिल्ड
िल से मात्रा र्ना ल ेंऔर स्ट्िॉक घोल म ें1.0 जम. ली. में 100 जम.ग्रा. िायरोजसन डालें तर्ा नीचे दी गई सारणी म ें
जनर्दवष्ट अनुसार प्रजत जम. ली. 75, 50 और 25 माइक्रोग्राम िायरोजसन रखन ेके जलए जनम्न सारणी म ेंिर्णवत जनर्दवष्ट
के अनुसार तीन और तनुकरण तैयार करें:
सारणी
ट्यर्ू नर्ं र स्ट्िॉक साल्यिू न का जडसरिल्ड िल सारं ता
क्र.स.ं
जम.ली. की जम.ली. (जम.ग्रा./जम.ली.)
(i) एस 1 2.5 7.5 25
(ii) एस 2 5.0 5.0 50
(iii) एस 3 7.5 2.5 75
(iv) एस 4 10.0 0.0 100
22.3 प्रकक्रया
(क) सब्लसरेि सॉल्यूिन के 10.0 जम. ली. जपपेि को िेस्ट्ि ट्यूर् में डालें और एंिाइम िेस्ट्ि नमूनों के जलए तीन प्रजतकृजत
ट्यूर् रखें (िी 1, िी 2 और िी 3 के रूप म ेंजचजह्नत करें), और ब्ललेंक के जलए एक ट्यूर् (र्ी के रूप म ेंजचजह्नत करें)।
(ख) ट्यूर्ों को 37± 0.1 o सेजल्सयस पर जस्ट्र्र ककय े गए गए िािर र्ार् में पंरह जमनि के जलए संतुजलत करें और
जनम्नजलजखत जस्ट्र्जतयों का पालन करें,
(i) िून्द्य समय पर संतुजलत सब्लसरेि सॉल्यूिन (िी 1, िी 2 और िी 3) के सार् ट्यूर्ों में सैंपल तैयारी के 2.0
जम.ली. को तेिी से डालें। सामग्री को जमलाएं और ट्यूर्ों को 37± 0.1 o सेजल्सयस पर र्नाए गए िािर
र्ार् में िापस रखें।
(ii) ब्ललेंक ट्यूर् (र्ी) में, सैंपल तैयारी के र्िाय ररस र्फर के 2 जम.ली. िोड़ें, सामग्री को जमलाए ंऔर ट्यूर्ों
को 37± 0.1 o सेजल्सयस पर र्नाए गए िािर र्ार् में िापस रखें।
(ग) 37 ± 0.1 o सेजल्सयस पर र्नाए गए िािर र्ार् म ें ठीक 30 जमनि के इन्द्क्यर्ू ेिन के र्ाद, प्रजतकक्रया को रोकन े
के जलए सभी ट्यूर्ों (िी1, िी2, िी3 और र्ी) म ें 10 जम. ली. राइक्लोरोएसेरिक एजसड घोल डालें।
(घ) ब्ललेंक ट्यूर् (र्ी) के जलए, िीसीए डालने के र्ाद 2 जम. ली. तैयार सैंपल डालें, सामग्री को तेज़ी से जमलाएँ।
(ङ) प्रोिीन को पूरी तरह से िमने दने े के जलए सभी ट्यूर्ों को 37± 0.1 o सेजल्सयस पर अजतररि 30 जमनि के जलए
िािर र्ार् में िापस रखें।
(च) दसू री हीरिंग अिजध के अंत म,ें प्रत्येक ट्यूर् को िोर स े जहलाएं और व्हािमैन नंर्र 42 या समकक्ष क़िल्िर पेपर
के माध्यम से क़िल्िर करें। पहल े3 जम. ली. क़िल्िर को त्याग दें। पूरी तरह से सा़ि क़िल्िरेि को इकट्ठा करें।
(छ) प्रत्येक सैंपल क़िल्िर उपकरण के अििोिण को िन्द्ू य पर जनधावररत करें और परीक्षण ओडी से (घ) ब्ललेंक ओडी
घिाकर िुद्ध अििोिण प्राप्त करें।
(ि) प्रकक्रया का सारांि जनम्न सारणी म ें कदया गया ह:ै[भाग II—खण्ड 3(ii)] भारत का रािपत्र : असाधारण 31
सारणी
(i) परीक्षण खाली
(ii) सब्लसरेि साल्यूिन 5.0 जम. ली. 5.0 जम. ली.
(iii) 37+ 0.1° सेजल्सयस पर र्नाए गए िािर र्ार् में 15 जमनि के जलए सतं ुजलत करें
(iv) कफर िोड़:ें
(v) एंिाइम साल्यूिन 2.0 0.0
घुमाकर जमलाएं और 37+ 0.1° सेजल्सयस पर 30 जमनि तक र्नाए रख े िािर र्ार्
(vi)
में रख ें
(vii) कफर िोड़:ें
(viii) िीसीए अजभकमवक 10 जम. ली. 10 जम. ली.
(ix) एंिाइम साल्यूिन 0.0 2.0 जम. ली.
(x) घुमाते हुए जमलाएं और 37° सेजल्सयस पर लगभग 30 जमनि तक रख ें
(xi) िॉिमैन नंर्र 42 या समकक्ष के माध्यम से क़िल्िर करें
(xii) 275 एन एम पर ररि स्ट्र्ान के सापेक्ष नमून े के अििोिण को माप ें
22.4 गणना
यजू नि पररभािा (पीसी): एक प्रोिीि यूजनि (पीसीयू) को एंिाइम की मात्रा के रूप में पररभाजित ककया िाता ह ैिो जिश्लेिण
की ितों के तहत प्रजत जमनि 1 माइक्रो ग्राम /जम.ली. िायरोजसन के र्रार्र उत्पादन करता ह।ै
गजतजिजध (पीसी/ग्राम) = िायरोजसन सांरता x 22/30 x डब्लल ू
िहाँ:
नमूने म ेंिायरोजसन सांरता मानक िक्र (किव) का उपयोग करके प्राप्त की िाती ह ै
22 प्रजतकक्रया जमिण की कुल मात्रा (जम.ली.) ह;ै
30 जमनिों में प्रजतकक्रया समय ह;ै
डब्लल ूग्राम में जलए गए मूल नमनू े का ििन ह ै
22.5 सदं भ:व
प्रोिीएज़ गजतजिजध; एफएओ, िेइसीएफए मोनोग्राफ; खाद्य योिक जिजनदेिों का संयुि सग्रं ह; खाद्य योिकों पर
संयुि एफएओ/ डब्ललूएचओ जििेिज्ञ सजमजत; खंड 4 जिश्लेिणात्मक जिजधयां, परीक्षण प्रकक्रयाएं और प्रयोगिाला
सल्यूिन, पष्ठृ 147. आईएसएसएन 1817-7077.
23. लाइपसे गजतजिजध का अिधारण
यह जिजध उस गजत पर आधाररत ह ैजिस पर एंिाइम पीएच 7.5 पर राइब्लयूरिररन को हाइड्रोलाइि करता ह।ै र्नन े
िाले ब्लयूरिररक एजसड को सोजडयम हाइड्रॉक्साइड के सार् अनमु ाजपत ककया िाता ह ैऔर सोजडयम हाइड्रॉक्साइड की खपत
को समय के एक ़िंक्िन के रूप में दि वककया िाता ह।ै
23.1 उपकरण
(क) पीएच स्ट्िेि िाइरेिन जसस्ट्िम: पीएच स्ट्िेि मोड म ेंकाम करने िाले और िैकेिेड िाइरेिन सेल (रेजडयोमीिर रिरालैर्
या समकक्ष) स े लैस एक उपकरण का उपयोग करें, इंस्ट्ूमेंिल असेंर्ली एक र्मोइलेजक्रक तापमान-जिजनयमन
चुंर्कीय जस्ट्िरर, एक मोिर चाजलत ब्लयरू ेि, एक स्ट्िचाजलत ररकॉडवर और एक पीएच मीिर से र्ना ह ै और पीएच
मीिर से जिद्युत आिेगों को ररकॉडवर इनपुि में स्ट्र्ानांतररत ककया िाता ह,ै िो र्दले में परख जमिण के जनरंतर
पीएच को र्नाए रखने के जलए एक माइक्रो जस्ट्िच के माध्यम से मोिर चाजलत ब्लयरू ेि को सकक्रय करता ह।ै
(ख) िािरर्ार्32 THE GAZETTE OF INDIA : EXTRAORDINARY [PART II—SEC. 3(ii)]
(ग) पीएच इलेक्रोड
(घ) चुंर्कीय जस्ट्िरर
23.2 रसायन और रेििें की तयै ारी
(क) सोजडयम हाइड्रॉक्साइड
(ख) पोिेजियम हाइड्रोिन फर्ैलेि
(ग) सोजडयम क्लोराइड
(घ) मोनोर्ेजसक पोिेजियम फॉस्ट्फेि
(ङ) जग्लसरॉल
(च) अरेजर्क गम
(छ) ररस (हाइड्रॉक्सीमेजर्ल)एजमनोमेर्ेन
(ि) ररब्लयूरिररन
(झ) 0.05N सोजडयम हाइड्रॉक्साइड (NaOH): 1.0 ग्राम सोजडयम हाइड्रॉक्साइड को पानी म ेंघोलें और 500 जम. ली. तक
तनु करें, पोिेजियम हाइड्रोिन फर्ैलेि के सार् अनुमापन करके नोमवजलिी को मानकीकृत करें।
(ञ) ईमल्सीकफकेसन रीिेंि : 17.9 ग्राम सोजडयम क्लोराइड और 0.41 ग्राम मोनोर्ेजसक पोिेजियम फॉस्ट्फेि को लगभग
400 जम. ली. पानी म ें घोलें, 540 जम. ली. जग्लसरॉल डाल,ें िोर से जहलात े हुए 6.0 ग्राम गम अरेजर्क डाल,ें घुलन े
तक जहलाएँ और 1000 जम. ली. तक तन ुकरें।
(ि) 10mM ररस र्फर (पी एच 8.0): 800 जम.ली. पानी में 12.1 ग्राम एंिाइम-ग्रडे (या समतुल्य) ररस
(हाइड्रॉक्सीमेजर्ल) एजमनोमर्े ने घोल,ें और 1N हाइड्रोक्लोररक एजसड के सार् पी एच 8.0 तक िाइरेि करें। 1,000-
जम.ली. िॉल्यूमेररक फ्लास्ट्क में रांसफर करें और जडजस्ट्िल्ड िॉिर से िॉल्यूम को 1000 जम.ली. तक र्ढ़ाएँ।
(ठ) सब्लसरेि इमल्िन: एक र्ीकर म ें15.9 जम.ली. राइब्लयूरिररन ल,ें 50 जम.ली. इमल्िन ररएिेंि और 235 जम.ली. पानी
डाल ें और तीन र्ार सोजनकेि करें और प्रत्येक सोजनकेिन के र्ीच 5 जमनि के अंतराल के सार् 5 जमनि के जलए 30
एम्पलीट्यडू पर जडजििल सोजनफायर के सार् सोजनकेि करें और उपयोग स े पहल े कम स े कम 15 जमनि के जलए
जनरंतर तापमान र्ार् म ें30o सजे ल्सयस पर संतुजलत करें, 4 घंिे के भीतर उपयोग करें।
(ड) नमूना तर्ा परीक्षण की तैयारी: एक सिीक तौली गई मात्रा को ररस र्फर, पीएच 8.0 में घोलें, ताकक इसमें 5000
से 8000 लाइपेस यूजनि/जम.ली. हो और इस घोल के एक जहस्ट्से को पानी के सार् सिीक रूप से पतला करें ताकक
अंजतम घोल म ें0.5 - 1.5 लाइपेस यूजनि प्रजत जम.ली. हो।
23.3 प्रकक्रया
(क) िाइरेिर ब्लयूरेि को 0.05N सोजडयम हाइड्रोक्साइड जिलयन स ेभरें।
(ख) सब्लसरेि इमल्िन के 15 जम. ली. को 100 जम. ली. डर्ल िॉल्ड ररएक्िन िेसल म ें डाल,ें िो छोिे जस्ट्िरर र्ार स े
सुसजित ह ैऔर ररएक्िन िेसल को 1000 आरपीएम पर जहलाते हुए ररकॉर्डांग पीएच स्ट्िेि म ें रखें;
(ग) तापमान को 30 o सेजल्सयस पर जनयंजत्रत ककया िाता ह,ै और पीएच को 7.0 पर समायोजित ककया िाता ह।ै
(घ) पहले स े30o सेजल्सयस पर िातानुकूजलत प्रजतकक्रया जमिण म ेंलाइपेस तैयारी की 1-जम. ली. मात्रा िोड़ें।
(ङ) लाइपेस के अंि के सार् प्रजतकक्रया िुरू होन े के र्ाद, ब्लयूरिररक एजसड के जनकलने के कारण पीएच म ेंजगरािि आती
ह ै और पीएच मीिर ररकॉडवर इनपुि को एक जिद्युत आिेग भिे ता ह,ै िो र्दल े में एक माइक्रो जस्ट्िच के माध्यम स े
मोिर-चाजलत ब्लयरू ेि को सकक्रय करता ह ैताकक राइब्लयूरिररन जमिण में मानक एनएओएच (0.05N) जमलाया िा सके,
ताकक पररक्षण जमिण का पीएच 7.0 जस्ट्र्र र्ना रह।े
(च) पीएच स्ट्िेि मानकीकृत र्ेस (0.05N NaOH) की खपत की गई मात्रा र्नाम समय ररकॉड वकरता ह।ै
(छ) 5 जमनि के जलए एक जस्ट्र्र (रैजखक) िोड़ने की दर देखी िाने के र्ाद अनुमापन र्ंद करें। (आमतौर पर जनधावरण के
जलए 5 जमनि की अिजध अनुमाजनत की िाती ह;ै 0.05N NaOH की मात्रा जडजििल रीडआउि से दि वकी िायेगी ।
23.4 गणना:
इकाइयों की पररभािा
1 िीर्ीयू (लाइपेस यूजनि) एिं ाइम की िह मात्रा ह ै िो दी गई मानक जस्ट्र्जतयों के तहत प्रजत जमनि 1 mol
िाइरेिेर्ल ब्लयूरिररक एजसड िारी करती ह।ै
जनम्न िर्णतव सूत्र द्वारा एंिाइम की गजतजिजध की गणना करें:
एलयू /ग्राम = आर x N x 1000/डब्लल ू[भाग II—खण्ड 3(ii)] भारत का रािपत्र : असाधारण 33
िहा ँ
(i) आर उस समय अतं राल म ें एनएओएच के योग की औसत दर ह ैिहाँ ढलान रैजखक ह,ै जमली लीिर /जमनि में;
(ii) N सोजडयम हाइड्रॉक्साइड घोल की नोमवजलिी ह;ै
(iii) 1000 mM को µM में पररिर्तवत करता ह ै
(iv) डब्लल ू15 जम. ली. सब्लसरेि इमल्िन म ेंजमलाए गए तन ुनमूना तयै ारी के 1 जम. ली. में जनजहत एिं ाइम का ििन
(ग्राम म)ें ह।ै
23.5 सदं भ:व -
लाइपेस गजतजिजध: खाद्य रसायन कोडेक्स, 11िीं खंड कोडेक्स जिजनदेि सजमजत, खाद्य और पोिण र्ोडव, िैजिक जिज्ञान
प्रभाग, िीिन जिज्ञान सभा, राष्ट्रीय अनुसंधान पररिद राष्ट्रीय अकादमी प्रेस, िाबिगं िन, डीसी, 2018।
24. 2-िोमो-(1एच)-इंडोल-3-कार्ोक्साजल्डहाइड का अिधारण
24.1 उपकरण
(क) एचपीएलसी -यूिी जसस्ट्िम
(ख) एनाजलरिकल र्लै ेंस
(ग) 0.45माइक्रोन जसररंि क़िल्िर
24.2 रसायन और अजभकमकव तयै ारी
(क) 2-िोमो-(1H)-इंडोल-3-कार्ोक्साजल्डहाइड (सीएएस नंर्र 119910-45-1)
(ख) एजसिोनाइराइल
(ग) मानक तैयारी के जलए, 2-िोमो-(1H)-इंडोल-3-कार्ोक्साजल्डहाइड के 10 जमलीग्राम को सही तरीके से तौल ेंऔर
इसे 10 जमली लीिर िॉल्यूमेररक फ्लास्ट्क में डालें और एजसिोनाइराइल से िॉल्यूम परू ा करें और यह 1000माइक्रो
ग्राम /जमली लीिर का स्ट्िॉक सॉल्यूिन देता ह।ै
(घ) मध्यिती मानक सॉल्यूिन के जलए, 1.0 जमली लीिर स्ट्िॉक मानक को एजसिोनाइराइल के सार् 10 जमली लीिर
तक तन ुकरें और अच्छी तरह से जमलाए,ँ यह 100 माइक्रो ग्राम / जमली लीिर का मध्यिती मानक सॉल्यूिन देता
ह,ै इस मध्यिती मानक सॉल्यूिन से, 1.0 जमली लीिर को एजसिोनाइराइल के सार् 10 जमली लीिर तक तन ुकरें,
यह 10 माइक्रो ग्राम / जमली लीिर का मध्यिती मानक सॉल्यिू न दते ा ह।ै
(ङ) नीचे दी गई सारणी म ेंजनर्दवष्ट नमूना सांरता के अनुसार रैजखकता बर्ंद ुतैयार करें-
सारणी
क्र.स.ं जलनीऐररिी स्ट्िॉक घोल की उपयोग ककए िान े उपयोग ककये मानक सांरता
मानक सांरता (पीपीएम) िाले स्ट्िॉक घोल िाने िाले (माइक्रो ग्राम /
की मात्रा (जमली पानी की मात्रा जमली लीिर)
लीिर ) (जमली लीिर )
(i) म ानक 1 10 पीपीएम 0.10 0.90 0.11
(ii) म ानक 2 10 पीपीएम 0.25 0.75 2.5
(iii) म ानक 3 10 पीपीएम 0.50 0.50 5.0
(iv) म ानक 4 10 पीपीएम 0.75 0.25 7.5
(v) म ानक 5 100 पीपीएम 0.10 0.90 10.034 THE GAZETTE OF INDIA : EXTRAORDINARY [PART II—SEC. 3(ii)]
(च) नमूना तैयार करना: 20 जमली लीिर िॉल्यूमेररक फ्लास्ट्क म ें 5.0 ग्राम परीक्षण नमून े का सही ििन लें,
एजसिोनाइराइल से मात्रा को परू ा करें, यकद आिश्यक हो, तो नमूने को और तनु करें, इस े0.45 माइक्रोन क़िल्िर स े
छान लें।
24.3 प्रकक्रया
(क) यूिी जडिेक्िर स े सुसजित एचपीएलसी म ें तनु घोल का 20 माइक्रो लीिर इंिेक्ि करें।
(ख) एचपीएलसी: नीच ेदी गई सारणी में जनर्दष्टव उपकरण प्रचालनातमक जस्ट्र्जतयों के अनुसार जिश्लेिण करें:
सारणी (एचपीएलसी जस्ट्र्जत)
(i) कॉलम सी 18 (250 x 4.6 जममी) 5 माइक्रोन कण आकार
(ii) जडिेक्िर यूिी
(iii) िेि लेंर् 210 एन एम
(iv) प्रिाह दर 0.8 जमली लीिर / जमनि
(v) मोर्ाइल फेि एजसिोनाइराइल: 0.1% ऑर्ो फॉस्ट्फोररक एजसड पानी म ें60:
40
(vi) रन िाइम 15 जमनि
(vii) कॉलम तापमान 25 o सेजल्सयस
(viii) इंिेक्िन िॉल्यूम 20 माइक्रो लीिर
24.4 गणना-
परीक्षण नमनू े म ें 2-िोमो-(1H)-इंडोल-3-कार्ोक्साजल्डहाइड का जनधावरण जमलीग्राम/ककलोग्राम म ें नीच े कदए गए सूत्र के
अनुसार करें-
ए x िी
एक्स 1 (जमलीग्राम/ककलोग्राम) =
एम
िहाँ,
(i) एक्स 1- 2-िोमो-(1H)-इंडोल-3-कार्ोक्साजल्डहाइड की सामग्री जमलीग्राम/ककग्रा में।
(ii) ए -परीक्षण नमूना घोल म ें 2-िोमो-(1H)-इंडोल-3-कार्ोक्साजल्डहाइड की गणना की गई सांरता
ग्राम/जमली लीिर में।
(iii) िी -परीक्षण नमनू े की मात्रा जमलीलीिर में.
(iv) एम - परीक्षण नमनू े का रव्यमान .
परीक्षण नमून े में 2-िोमो-(1H)-इंडोल-3-कार्ोक्साजल्डहाइड का प्रजतित (%) सूत्र का उपयोग करके गणना की िाती ह:ै
एक्स 1 (जमलीग्राम/ककग्रा)
2-िोमो-(1H)-इंडोल-3-कार्ोक्साजल्डहाइड (% )=
10000[भाग II—खण्ड 3(ii)] भारत का रािपत्र : असाधारण 35
25. जलपो-जचिूजलगोसकै ेराइ्स (एलसीओ ) का अिधारण
25.1 उपकरण
(क) कैजलिेिेड जपपेि
(ख) स्ट्क्रू कैप के सार् ऑिो सैंपलर िीिी:
(ग) सेंरीफ्यूि ट्यूर्
(घ) िोरिेक्स जमक्सर
(ङ) सोजनकिर
(च) एनाजलरिकल र्लै ेंस
(छ) 0.2 माइक्रोन जसररंि क़िल्िर
25.2 रसायन और अजभकमकव तयै ारी
(क) पानी
(ख) एसीिोजनराइल
(ग) मेर्नॉल
(घ) डाइमेजर्ल सल्फोक्साइड (डीएमएसओ)
(ङ)एलसीओ (जलपो-जचिूजलगोसैकेराइ्स) (सीएएस संख्या 168843-28-5)
(च) 30:70 एसीिोजनराइल: पानी
(i) एक साफ कांच की र्ोतल म ें30 जम. ली. एजसिोनाइराइल डाल ें
(ii) र्ोतल म ें70 जम. ली. पानी डाल ें
(iii) ढक्कन लगाएं और एकरूपता सुजनजश्चत करने के जलए अच्छी तरह जमलाएं
(क) 45:55 एसीिोजनराइल: पानी
(i) एक साफ कांच की र्ोतल म ें45 जम. ली. एजसिोनाइराइल डाल ें
(ii) र्ोतल म ें55 जम. ली. पानी डाल ें
(iii) ढक्कन लगाएं और एकरूपता सुजनजश्चत करने के जलए अच्छी तरह जमलाएं
(ख) 50:50 एसीिोजनराइल: पानी
(i) एक साफ कांच की र्ोतल म ें50 जम. ली. एजसिोनाइराइल डाल ें
(ii) र्ोतल म ें50 जम. ली. पानी डाल ें
(iii) ढक्कन लगाएं और एकरूपता सुजनजश्चत करने के जलए अच्छी तरह जमलाए ं
(ग) 60:40 मर्े नॉल: पानी
(i) एक साफ कांच की र्ोतल म ें60 जमली लीिर मेर्नॉल डाल ें
(ii) र्ोतल म ें40 जम. ली. पानी डाल ें
(iii) ढक्कन लगाएं और एकरूपता सुजनजश्चत करने के जलए अच्छी तरह जमलाएं
25.3 मानक और क्यसू ी जिलयन
(क). स्ट्िॉक मानक
(i) लगभग 0.09 भार % जलपो-चाइिूजलगोसेकेराइ्स (एलसीओ) स्ट्िॉक मानक घोल की तैयारी जनम्नानुसार ह,ै
अर्ावत:् -
(क) खाली 8 ड्राम (या समतुल्य) िीिी को जनकितम 0.0001 ग्राम तक तौल;ें
(ख) ड्राम िीिी म ेंन्द्यूनतम 0.010 ग्राम जलपो-चाइिूजलगोसेकेराइ्स को जनकितम 0.0001 ग्राम तक तौल;ें और
(ग) जनम्नजलजखत समीकरण का उपयोग करके 0.09 ििन% जलपो-चाइिूजलगोसेकेराइ्स की अनुमाजनत सांरता
प्राप्त करन े के जलए िीिी में जमलाए िान े िाले डाइमेजर्ल सल्फॉक्साइड की मात्रा की गणना करें-:36 THE GAZETTE OF INDIA : EXTRAORDINARY [PART II—SEC. 3(ii)]
एलसीओ % िुद्धता x ग्राम एलसीओ
0.09 िेि % एलसीओ =
ग्राम एलसीओ + ग्राम डाइमेजर्ल सल्फोक्साइड
रिप्पण : उपरोि समीकरण में जलपो-चाइिूजलगोसेकेराइ्स िद्धु ता (%) और ग्राम जलपो-चाइिूजलगोसेकेराइ्स इनपुि करें,
ग्राम डाइमेजर्ल सल्फोक्साइड के जलए हल करें।
(ii) ड्राम िीिी म ेंडाइमेजर्ल सल्फॉक्साइड की गणना की गई मात्रा डाल;ें
(iii) अंजतम जलपो-चाइिूजलगोसेकेराइ्स + डाइमेजर्ल सल्फॉक्साइड घोल को जनकितम 0.0001 ग्राम तक तौल;ें
(iv) पाँच जमनि के जलए सोजनकेि करें;
(v) न्द्यूनतम 15 सेकंड तक िोरिेक्स करें;;
(vi) चरण ‘(iv)’ और ‘(v)’ को कम स े कम दो र्ार दोहराए,ँ या िर् तक घोल साफ न हो िाए;
(vii) यह सुजनजश्चत करने के जलए दश्ृ य जनरीक्षण करें कक जलपो-चाइिूजलगोसेकेराइ्स घोल म ें चला गया ह;ै
(viii) स्ट्िॉक मानक की सांरता ििन % म ेंजनम्नजलजखत समीकरण का उपयोग करके गणना की िाती ह:ै
स्ट्िॉक मानक ििन % एलसीओ = (ग्राम एलसीओ /ग्राम कुल सोल्यूिन) x % एलसीओ िुद्धता
उदाहरण गणना:
(0.0113 ग्राम एलसीओ / 12.5521 ग्राम कुल सोल्यूिन) x 87.4% िुद्धता = 0.07868 िेि % एलसीओ
(ix) िल्े फ िीिन और भंडारण की जस्ट्र्जत: मानक स्ट्िॉक समाधान का उपयोग तैयारी के कदन ही ककया िाना चाजहए और
उपयोग म ेंन होन े पर इस ेप्रकाि से दरू रखा िाना चाजहए।
(ख). इंिरमीजडएि मानक
(i) लगभग 0.001 भार % जलपो-चाइिूजलगोसेकेराइ्स मध्यिती मानक घोल की तैयारी जनम्नानुसार ह:ै-
(क) एक खाली 8 ड्राम (या समतल्ु य) िीिी का ििन जनकितम 0.0001 ग्राम तक मापें
(ख) 8 ड्राम की िीिी म ेंलगभग 0.22 जम. ली. स्ट्िॉक स्ट्िैण्डड वजमलाएं
(ग) 8 ड्राम िीिी + स्ट्िॉक मानकों को जनकितम 0.0001 ग्राम तक तौलें
(घ) 8 ड्राम की िीिी म ेंलगभग 20 जम. ली. 30:70 एजसिोजनराइल: पानी जमलाएं
(ङ) अंजतम जमिण को जनकितम 0.0001 ग्राम तक तौल ें
(च) न्द्यूनतम 15 सेकंड तक िोरिेक्स करें
(ii) ििन % म ें मध्यिती मानक की सांरता की गणना जनम्नजलजखत समीकरण का उपयोग करके की िाती ह:ै
मध्यिती मानक िेि % एलसीओ = स्ट्िॉक मानक िेि % एलसीओ x ( ग्राम स्ट्िॉक मानक / ग्राम कुल सोल्यूिन)
मध्यिती मानक की उदाहरण गणना –
स्ट्िॉक मानक जलपो-चाइिूजलगोसेकेराइ्स सांरता 0.07868 ििन % के जलए ििन % -
0.07868 िेि % एलसीओ x (0.2444 ग्राम स्ट्िॉक मानक / 19.3037 ग्राम कुल सोल्यिू न ) = 0.0009962 िेि
% एलसीओ[भाग II—खण्ड 3(ii)] भारत का रािपत्र : असाधारण 37
(iii) िेल्फ लाइफ और भंडारण की जस्ट्र्जत: मध्यिती मानक घोल का उपयोग तैयारी के कदन ही ककया िाना चाजहए
और उपयोग म ें न होन े पर उसे प्रकाि स े दरू रखा िाना चाजहए।
(ग ) िर्कांग कैलीििे न मानक-
(i) िर्कांग कैलीिेिन स्ट्िैंडड व को लगभग 0.00004 भार % से 0.0008 भार % जलपो-जसिोऑजलगोसेकेराइ्स
की सीमा को िाजमल करने के जलए ग्रेिीमेररक रूप से तैयार ककया िाता ह,ै इंिरमीजडएि स्ट्िैंडडव को 30 : 70
एजसिोजनराइल:पानी के सार् तनु करके जनम्न िर्णवत अनुसार तयै ार ककया िाता है-
(क) तैयारी के जलए पांच खाली आठ ड्राम (या समतल्ु य) िीजियों का िेि जनकितम 0.0001 ग्राम तक करें
रिप्पण : पांच िर्कांग कैलीिेिन स्ट्तरों में स ेप्रत्येक के जलए एक िीिी होगी;
(ख) नीचे दी गई सारणी म ेंजनर्दवष्ट संगत आठ ड्राम िीिी में इंिरमीजडएि मानक की जनम्नजलजखत मात्रा िोड़ें: -
सारणी
क्र. सं. मानक इंिरमीजडएि स्ट्िैंडड(व जम.ली.).
(i) मानक 5 8.00
(ii) मानक 4 5.00
(iii) मानक 3 3.00
(iv) मानक 2 1.00
(v) मानक 1 0.40
(ग) प्रत्येक िीिी का िेि + इंिरमीजडएि स्ट्िैंडड व जनकितम 0.0001 ग्राम;
(घ) नीचे दी गई सारणी म ें जनर्दष्टव अनुसार 30:70 एसीिोजनराइल: पानी की जनम्नजलजखत मात्रा को संर्ंजधत आठ
ड्राम िीिी म ेंिोड़:ें -
सारणी
क्र. सं. मानक 30:70 एसीिोजनराइल : पानी (जम.ली.)
(i) मानक 5 2.0
(ii) मानक 4 5.0
(iii) मानक3 7.0
(iv) मानक 2 9.0
(v) मानक 1 9.6
(ङ) प्रत्येक पूण व िीिी का िेि जनकितम 0.0001 ग्राम तक करें;
(च) न्द्यूनतम पंरह सेकंड तक िोरिेक्स करें;
(छ) प्रत्येक मानक की 1जमली लीिर मात्रा को एचपीएलसी िीिी में स्ट्र्ानांतररत करें; और
(ि) कैप िीिी का एचपीएलसी के माध्यम से जिश्लेिण करें।
(ii) ििन % म ेंिर्कांग कैलीिेिन मानक की सांरता की गणना जनम्नजलजखत समीकरण का उपयोग करके की िाती
ह:ै
िर्कांग कैलीिेिन मानक भार % एलसीओ = इंिरमीजडएि स्ट्िैंडडवभार % एलसीओ x (ग्राम इंिरमीजडएि स्ट्िैंडड/व
ग्राम कुल जिलयन)
मानक 1 की उदाहरण गणना: 0.0010 िेि % जलपो-जसिोऑजलगोसेकेराइ्स की एक इंिरमीजडएि
स्ट्िैंडडवसांरता का उपयोग कर दिावया गया ह-ै
0.0010 िेि % एलसीओ x (7.5200 ग्राम इंिरमीजडएि स्ट्िैंडड/व 9.4000 ग्राम कुल जिलयन) = 0.0008 िेि
% एलसीओ38 THE GAZETTE OF INDIA : EXTRAORDINARY [PART II—SEC. 3(ii)]
(iii) िेल्फ लाइफ और भडं ारण की जस्ट्र्जत - िर्कांग कैलीिेिन स्ट्िैंडड व को प्रिीजतत तापमान (4o सेजल्सयस) और
अंधेरे में साठ कदनों तक संग्रहीत और उपयोग ककया िा सकता ह।ै
रिप्पण : िर्कांग कैलीिेिन स्ट्िैंडड वको कमरे के तापमान पर लाएं और भजिष्य म ेंउपयोग के जलए खोलन ेसे पहल े
कम से कम पंरह सेकंड के जलए िोरिेक्स करें.
(घ) गणु ित्ता जनयत्रं ण िाचं मानक-
(i) गणु ित्ता जनयंत्रण िांच मानक को स्ट्िॉक मानक घोल से सीधे तनु ककया िाता ह ैऔर िर्कांग कैलीिेिन स्ट्िैंडडव के
सापेक्ष जिश्लेिण ककया िाता ह,ै इससे िर्कांग कैलीिेिन स्ट्िैंडड वकी सिीकता की िांच होती ह।ै
(क) तैयारी के जलए एक खाली आठ ड्राम (या समतुल्य) िीिी को जनकितम 0.0001 ग्राम तक मापें;
(ख) आठ ड्राम िीिी में 0.1 जम.ली. स्ट्िॉक मानक जमलाएं;
(ग) िीिी + स्ट्िॉक मानक को जनकितम 0.0001 ग्राम तक मापें;
(घ) आठ ड्राम की िीिी में 25 जम. ली. 30:70 एजसिोजनराइल: पानी जमलाएं;
(ङ) प्रत्येक पूण व िीिी का िेि जनकितम 0.0001 ग्राम तक करें;
(च) न्द्यूनतम पंरह सेकंड का िोरिेक्स;
(छ) प्रत्येक मानक की लगभग 1 जम. ली. मात्रा को एच.पी.एल.सी. िीिी में स्ट्र्ानांतररत करें; तर्ा
(ि) कैप िीिी और एचपीएलसी के माध्यम से जिश्लेिण करें
(ii) गुणित्ता जनयंत्रण िांच मानक की िेि % म ेंसांरता की गणना जनम्नजलजखत समीकरण का उपयोग करके की िाती
ह-ै
गुणित्ता जनयंत्रण िाँच मानक ििे % एलसीओ = स्ट्िॉक मानक िेि % एलसीओ x (ग्राम स्ट्िॉक मानक/ग्राम
कुल जिलयन)
उदाहरण गणना: स्ट्िॉक मानक सांरता 0.09 िेि % जलपो-जसिोऑजलगोसेकेराइ्स- का उपयोग करके एक
गुणित्ता जनयंत्रण िांच मानक दिावया गया ह ै
0.09 िेि % एलसीओ x (0.1000 ग्राम स्ट्िॉक मानक / 23.6438 ग्राम कुल जिलयन) = 0.000381 िेि
% एलसीओ
(iii) िेल्फ लाइफ और भंडारण की जस्ट्र्जत-गणु ित्ता जनयंत्रण नमनू े को प्रिीजतत तापमान (4 जडग्री सेजल्सयस) और अधं ेरे
में साठ कदनों तक संग्रहीत और उपयोग ककया िा सकता ह।ै
रिप्पण : गुणित्ता जनयंत्रण नमनूे को कमरे के तापमान पर लाएं और भजिष्य में उपयोग के जलए खोलन ेस ेपहल ेकम
से कम पंरह सेकंड के जलए िोरिेक्स में रखें।
(ङ) एचपीएलसी-यूिी के जलए सेंपल तैयार करना -
सपें ल तयै ारी अिलोकन:
यह जिजध जलपो-चाइिोजलगोसैकेराइ्स सांरता के जलए लागू ह:ै 2.5 x 10 -5 िेि% जलपो-चाइिोजलगोसैकेराइ्स
सेंपल सांरता चरण का अिलोकन नीचे दी गई सारणी में जनर्दवष्ट ह:ै
सारणी
क्र. सं. लक्ष्य जलपो- फेज़ एक्सरैक्िन उत्सर्िवत अंि के एचपीएलसी जिश्लेिण
जसिोऑजलगोसेकेराइ कार्रवि पर लगान े तनुकरण के र्ाद के जलए सेंपल तैयार
्स एकाग्रता (िेि % के जलए नमून े की तनुकरण कारक करने के अंत में लक्ष्य
जलपो- अनुमाजनत मात्रा (जम.ली.) जलपो-
जसिोऑजलगोसेकेराइ (जमली लीिर ) जसिोऑजलगोसेकेराइ
्स) ्स सांरता (िेि %)
(i) 2.5 x 10 -5 250 2.5 0.00025[भाग II—खण्ड 3(ii)] भारत का रािपत्र : असाधारण 39
25.4 प्रकक्रया-
(क) मात्रात्मक जनधावरण के जलए एचपीएलसी-यूिी प्रणाली और मानक रैजखकता आरेखों का उपयोग करके सकक्रय
घिक का जिश्लेिण करना;
(ख) जलपो-चाइिोजलगोसेकेराइ्स को सांकरत करने और मैररक्स घिकों (िो क्रोमैिोग्राफी में र्ाधा डालते ह)ैं को
हिाने के जलए सॉजलड फेि एक्सरेक्सन (एसपीई) का उपयोग करके एचपीएलसी जिश्लेिण के जलए नमनू े
तैयार करना
(ग) सॉजलड फेि एक्सरेक्सन प्रकक्रया-
(i) एक कंिेनर में लगभग 250 जम.ली. सेंपल डालें;
रिप्पण : उपयोग से पहले कम से कम तीस र्ार पलिकर सुजनजश्चत करें कक सेंपल समरूप ह;ै तर्ा परीक्षण
ककए गए प्रत्येक र्ैच के जलए डुजप्लकेि तैयारी करें।
(ii) नमूने और कंिेनर का िेि जनकितम 0.01 ग्राम तक करें;
(iii) र्ाद में उपयोग के जलए अलग रखें;
(iv) एसपीई कार्िवि के माध्यम से 15 जम.ली. एचपीएलसी ग्रेड एजसिोनाइराइल गुिार कर कंडीिन करें;
सुझाि: सॉजलड फेि एक्सरैक्िन कार्रवि के माध्यम से जिलायक को र्ूंद-र्ूंद की गजत स ेप्रिाजहत करन े
का ध्यान रख ेंऔर सॉजलड फेि एक्सरैक्िन मैजनफोल्ड पर स्ट्िॉपर को समायोजित करके प्रिाह दर को
जनयंजत्रत करें।
(v) सॉजलड फेि एक्सरैक्िन कार्िवि के माध्यम से 15 जम.ली. एचपीएलसी ग्रेड मेर्नॉल गुिार कर कंडीिन
करें;
(vi) सॉजलड फेज़ एक्सरैक्िन कार्रवि के माध्यम से 15 जम. ली. एचपीएलसी ग्रडे पानी गुिार कर संतलु न
र्नाएं;
(vii) चरण '(i)' से '(iii)' तक भाररत नमूने प्राप्त करें;
(viii) सॉजलड फेज़ एक्सरैक्िन कार्रवि पर 250 जमली लीिर सेंपल लोड करें;
सुझाि: प्रिाह दर को जनयंजत्रत करें ताकक नमूने को सॉजलड फेि एक्सरैक्िन सोरर्ेंि के सार् अंतःकक्रया
करने के जलए पयावप्त समय जमल,े इल्युि र्ूंद-र्ूंद होना चाजहए।
(ix) एक र्ार सभी नमून े डाल कदए िाने के र्ाद, कंिेनर और सेंपल अििेि को जनकितम 0.01 ग्राम तक
मापें;
(x) सॉजलड फेज़ एक्सरैक्िन कार्रवि पर लोड ककए गए नमूने के ग्राम की गणना करने के जलए चरण '(ix)'
और चरण '(ii)' से भार को घिाएं;
(xi) सॉजलड फेि एक्सरैक्िन कार्रवि के माध्यम स ेएचपीएलसी िाइप-1 पानी के तीन 10 जम.ली. भागों को
गुिार कर धोएं;
(xii) ठोस चरण जनष्किणव कार्िवि के माध्यम से 60:40 मेर्नॉल: पानी के तीन 10 जम.ली. भागों को गुिार
कर धोएं;
(xiii) 30 : 70 एजसिोनाइराइल : पानी के तीन 10 जम.ली. भागों को सॉजलड फेि एक्सरैक्िन कार्रवि के
माध्यम से गुिार कर धोए;ं
(xiv) एसीिोजनराइल:पानी के एक 5 जम.ली. भाग को सॉजलड फेि एक्सरैक्िन कार्रवि से गुिार कर धोएं;
तर्ा
(xv) जिजिष्ट जलपो-जसिोऑजलगोसेकेराइ्स सेंपल सांरता के जलए नीचे कदए गए इल्युि चरण पर आग े र्ढ़ें ।
(घ) 2.5 x 10-5 िेि% जलपो-जसिोऑजलगोसेकेराइ्स सॉजलड फेि एक्सरैक्िन इल्युि और ििे सेंपल तैयारी,
अर्ावत:् -
(i) प्रत्येक सॉजलड फेज़ एक्सरैक्िन कार्रवि के जलए एक खाली 15 जम.ली. सेंरीफ्यूि ट्यूर् का िेि जनकितम
0.0001 ग्राम तक करें;
(ii) एल्युएि को इकट्ठा करन े के जलए 15 जमली लीिर सेंरीफ्यूि ट्यूर् के सार् र्दल;ें
(iii) 50:50 एजसिोनाइराइल: िल के एक 10 जम.ली. भाग को सॉजलड फेज़ एक्सरेक्िन कार्िवि के माध्यम
से गुिार कर जनस्ट्ताररत करें;40 THE GAZETTE OF INDIA : EXTRAORDINARY [PART II—SEC. 3(ii)]
(iv) 15 जम.ली. सेंरीफ्यूि ट्यूर् म ेंजनकाले गए नमनू ेएकत्र करें और जनकितम 0.0001 ग्राम तक ििे ररकॉड व
करें;
(v) अंजतम सेंपल भार जनधावररत करने के जलए चरण '(iv)' और '(i)' घिाएं;
(vi) नमूनों को एक ऑिो सैंपलर िीिी म ें 400 माइक्रो लीिर म ें जपपेि करके 600 माइक्रो लीिर 30:70
एसीिोजनराइल: पानी स ेतन ु करें;
(vii) सेंपल को कैप और िोरिेक्स करें;
(viii) लगभग 1 जम.ली. नमून े को 0.2 माइक्रोन कफल्िर के माध्यम से एचपीएलसी िीिी म ेंडालें; तर्ा
(ix) कैप िीिी को िोरिेक्स करें और एचपीएलसी का उपयोग कर जिश्लेिण करें ।
(ङ) एचपीएलसी-यूिी द्वारा अंजतम जनधावरण -
तरल क्रोमिै ोग्राफी जिजध परै ामीिर नीच ेजनर्दष्टव हैं-
(i) मोर्ाइल चरण ए : पानी;
(ii) मोर्ाइल चरण र्ी : एसीिोजनराइल;
(iii) िाि सोलिेंि: एसीिोजनराइल;
(iv) कॉलम: सी 18, 4.6 x 250 जममी, 5 माइक्रोन;
(v) कॉलम ओिन सेरिंग: 50 ° सेजल्सयस;
(vi) इंिेक्िन िॉल्यूम: 100 माइक्रो लीिर;
(vii) प्रिाह दर: 1.0 जम.ली./जमनि;
(viii) िेिलेंर् : जिश्लेिण और पररमाणीकरण के जलए 200 नैनो मीिर;
(ix) रन िाइम: साठ जमनि; और
(x) तरल क्रोमैिोग्राफी ग्रेजडएंि जििरण जनम्नजलजखत सारणी म ेंजनर्दवष्ट ह:ै-सारणी
क्र.स.ं समय (जमनि) % र्ी (एजसिोनाइराइल)
(i) 0 30
(ii) 5 30
(iii) 50 50
(iv) 52 100
(v) 53 100
(vi) 54 30
(vii) 60 30
जलपो-चाइिोजलगोसेकेराइ्स के जलए अपेजक्षत अिधारण समय ~45.0 जमनि ह,ै सिीक अिधारण समय
क्रोमैिोग्राकफक जस्ट्र्जतयों के कारण र्दल सकता ह ै और प्रत्येक जिश्लेिण के जलए मानकों के सार् इसकी पुजष्ट की
िानी चाजहए।
(च) केलीिेिन प्रकक्रया -
(i) पररणामों की गणना केलीिेिन किव का उपयोग करके पीक इंिेंजसिी मेिरमेंि (पीक एररया) पर आधाररत
ह;ै
(ii) मानक िक्र प्राप्त करन े के जलए 0.00004 भार % से 0.0008 भार % की सीमा को किर करते हुए
एचपीएलसी-यूिी उपकरण में मानक समाधान नमूनों के जिजभन्न सांरताओं का एक सेि इंिक्े ि करें;
(iii) इंिेक्ि ककए गए जिश्लेिक समाधान की सांरता के सापेक्ष किव क्षेत्र को प्लॉि करके केलीिेिन िक्र प्राप्त करें
;
(iv) मानकों की कई सांरताओं को इंिेक्ि करके जडिेक्िर प्रजतकक्रया की जस्ट्र्रता स्ट्र्ाजपत करें; और
(v) स्ट्िीकृजत मानदंड द्वारा एक र्ैच के जलए केलीिेिन रेंि जनधावररत करें, अर्ावत:् -
(1) 80% मानकों की पूिव-गणना सिीकता नाममात्र सांरता के 15% के अंदर होनी चाजहए; तर्ा
(2) मानकों के जलए प्रजतगमन जिश्लिे ण का आर2 0.985 या उससे अजधक होना चाजहए ।[भाग II—खण्ड 3(ii)] भारत का रािपत्र : असाधारण 41
25.5 गणना-
जलपो-चाइिोजलगोसेकेराइ्स के जलए र्ाह्य मानक िक्र का उपयोग करके नमनू ों की मात्रा जनधावररत की िाती ह,ै
केलीिेिन मानक से डेिा को रैजखक प्रजतगमन के सार् कफि ककया िाता ह ै जिससे एचपीएलसी नमूनों में जलपो-
चाइिोजलगोसेकेराइ्स की सांरता जनधावरण के जलए सूत्र का उपयोग करते हुए पूिावनुमान समीकरण प्राप्त ककया िा
सके:
एक्स = (िाई -र्ी )/एम
िहाँ,
(i) िाई = जलपो-चाइिोजलगोसैकेराइ्स का पीक एररया
(ii) एम = केलीिेिन िक्र का स्ट्लॉप
(iii) र्ी = केलीिेिन िक्र का अिरोधन
(iv) एक्स = जलपो-चाइिोजलगोसेकेराइ्स की मापी गई सांरता (िेि %) इंिेक्िेड ककए गए
एचपीएलसी नमून े म ें
गणना: 2.5 x 10-5 िेि % जलपो-चाइिोजलगोसैकेराइ्स (एलसीओ ) नमून-े 2.5 x 10-5 भार % एलसीओ की
सैद्धांजतक सांरता से िरूु करत ेहुए नमूनों म ें एलसीओ की मात्रा जनधावररत करन े के जलए जनम्नजलजखत गणनाओं का
उपयोग करें :
(1.) सॉजलड फेज़ एक्सरैक्िन (एसपीई ) कार्रवि पर लोड ककए गए नमनू ेका ििे जनधारव रत करें-
एसपीई पर सेंपल लोड ककया गया (ग्राम) = [कंिेनर सेंपल (ग्राम)] - [कंिेनर + सेंपल अिसेि (ग्राम)]
उदाहरण गणना -
एसपीई पर 253.22 ग्राम लोड = 526.35 ग्राम पूण व - 273.13 ग्राम अििेि सजहत खाली
(2.) एचपीएलसी जिश्लिे ण स ेपहल ेअजं तम नमनू ेका ििे जनधावररत करें:
डायल्यूिेड सेंपल िेि (ग्राम) = [पूरी 15 जम. ली. ट्यूर् (ग्राम)]–[खाली 15 जम. ली. ट्यूर् (ग्राम)]
उदाहरण गणना:
8.75123 ग्राम सेंपल = 15.61920 ग्राम पूरा - 6.86797 ग्राम खाली
(3 ) प्रत्यके नमनू ेम ें एलसीओ की सारं ता (भार%) की गणना करें:
िेि % एलसीओ = (एचपीएलसी िेि % एलसीओ + [फाइनल सेंपल िेि (ग्राम)]/ एसपीई पर लोड ककया
गया सेंपल (ग्राम)]* 2.5
इस समीकरण म,ें एचपीएलसी भार % एलसीओ एचपीएलसी आउिपुि ह ैऔर 2.5 डायल्यूिन फैक्िर ह।ै
उदाहरण गणना:
2.56 x 10-5 िेि % एलसीओ = (0.000297048 िेि % एलसीओ x (8.75123 ग्राम / 253.22 ग्राम) x
2.5
26. िसै ीसीन का अिधारण -
26.1 उपकरण-
(क) एचपीएलसी
(ख) यूिी जडिेक्िर
(ग) माइक्रो र्ैलेंस
(घ) एनाजलरिकल र्लै ेंस
(ङ) सोजनकेिर
26.2 आपजे क्षत रसायन एि ं अजभकमवक-
(क) िाइप-I िल
(ख) एचपीएलसी ग्रडे एसीिोजनराइल42 THE GAZETTE OF INDIA : EXTRAORDINARY [PART II—SEC. 3(ii)]
(ग) ऑर्ोफॉस्ट्फोररक एजसड
(घ) िैसीजसन (सीएएस न. : 6159-55-3)
(ङ) मोर्ाइल फेज़-
(i) मोर्ाइल फेि (ए) : िाइप I पानी युि 1000 जम.ली. मोर्ाइल फेि र्ोतल म ें5 जम.ली. ऑर्ोफॉस्ट्फररक
एजसड डाल,ें अच्छी तरह जमलाए ं और दस जमनि के जलए सोजनकेि करें और मोर्ाइल फेि –ए के रूप म ें
उपयोग करें।
(ii) मोर्ाइल फेि (र्ी): 1000 जम.ली. एचपीएलसी ग्रडे एजसिोनाइराइल को 1000 जम.ली. मोर्ाइल फेि
की र्ोतल म ेंस्ट्र्ानांतररत करें और मोर्ाइल फेि -र्ी के रूप म ें उपयोग करें।
(च) डाल्यूएंि और ब्ललैंक जिलयन की तैयारी- एचपीएलसी ग्रडे एजसिोनाइराइल का उपयोग डाइल्यूएंि और ब्ललैंक
जिलयन के रूप म ें ककया िाना ह।ै
(छ) संदभ व मानक स्ट्िॉक और कायविील जिलयन की तैयारी-
(i) 5.0 ± 1.0 जम.ग्रा. िैसीजसन मानक (ज्ञात िुद्धता का) ििन करें और इस े 5 जम.ली. िॉल्यूमेररक फ्लास्ट्क म ें
स्ट्र्ानांतररत करें;
(ii) पदार् व को घोलन ेके जलए 4 जम.ली. एसेन्द्िोनाइराइल जमलाए,ं मात्रा को एजसिोनाइराइल के सार् 5 जम.ली.
तक र्नाए ं और दस जमनि के जलए सोजनकेि करें, यह 1000 माइक्रो ग्राम /जमली लीिर का स्ट्िॉक जिलयन
देता ह ै; और
(iii) उपरोि डाइल्यूिेड स्ट्िॉक जिलयनों म ेंस े0.1 जम.ली. ल ेंऔर इसे 100 जम.ली. िॉल्यूमेररक फ्लास्ट्क म ेंडाल ें
और एजसिोनाइराइल स े आयतन पूरा करें। इससे 1 माइक्रो ग्राम /जमली लीिर का कायविील जिलयन प्राप्त
होता ह।ै
(ि) िेस्ट्ि आइिम स्ट्िॉक और कायविील जिलयन की तैयारी-
(i) िेस्ट्ि सैंपल का 880± 10.0 जम.ग्रा. सिीक ििन करें और इस ेदो अलग-अलग 5 जम.ली.िॉल्यूमेररक फ्लास्ट्क
म ें स्ट्र्ानांतररत करें;
(ii) पदार्व को घोलन े के जलए 4 जम. ली. एसेन्द्िोनाइराइल जमलाए ंऔर दस जमनि के जलए सोजनकेि करें; तर्ा
(iii) जिलयन को 10 जमनि के जलए कमरे के तापमान पर इकक्वजलििे होने दें और मात्रा को एजसिोनाइराइल
के सार् 5 जम. ली. तक कर द।ें
26.3 प्रकक्रया -
(क) सैंपल या मानक के 20 माइक्रो लीिर को एचपीएलसी के इंिेक्िर म ेंइंिेक्ि करें।
(ख) एचपीएलसी जिश्लेिण : नीच ेदी गई सारणी म ें दी गयी जस्ट्तजर्यों अनुसार ।
सारणी (एचपीएलसी जस्ट्र्जत)
(i) उपकरण एचपीएलसी
(ii) कॉलम सी18 (250 जममी x 4.6 जममी आईडी x 5 माइक्रोन
कण आकार)
(iii) जडिेक्िर यूिी
(iv) मोर्ाइल फेि (ए:र्ी ) ए: 20% पानी म ें 0.5% ऑर्ोफॉस्ट्फोररक एजसड (िी
/िी )
र्ी: एसीिोजनराइल 80% (िी /िी )
(v) इंिेक्िन की मात्रा 20 माइक्रो लीिर
(vi) फ्लो रेि 0.5 जम.ली./जमनि
(vii) एंड िाइम/स्ट्िॉप िाइम 8.00 जमनि
(viii) िेिलेंर् 280 एन एम
(ix) कॉलम ओिन तापमान 30o सेजल्सयस
(x) र्मोस्ट्िेि या ऑिो सैंपलर तापमान 25 o सेजल्सयस
(xi) ररिेंिन िाइम 3.6 जमनि[भाग II—खण्ड 3(ii)] भारत का रािपत्र : असाधारण 43
26.4 गणना-
सैंपल सॉल्यिू न का
स्ट्िैंडड व का कॉन्द्सन्द्रेसन
एररया
x x स्ट्िैंडड व प्योररिी
एजक्िि इनग्रेजडएंि = स्ट्िैंडड व सॉल्यूिन का
सैंपल का कॉन्द्सन्द्रेिन
एररया
िैसीजसन कॉन्द्िेन्द्ि (पीपीएम) = िैसीजसन कॉन्द्िेन्द्ि (% डब्लल ू /डब्ललू ) x 10000
26.5 सदं भ-व
(i) िीिास्ट्ति एस, िमाव आरके , गप्तु ा एम एम , बसंह, और कुमार एस 2001, फोिो डायोड ऐरे जडिेक्िन के सार्
एडािोडा िाजसका म ेंिैसीजसन और िैसीजसनोन का एच.पी.एल.सी. जनधारव ण। िनवल ऑफ जलकक्वड क्रोमैिोग्राफी
और संर्ंजधत तकनीक 24: 153–159 ।
(ii) मािोजलया ि,े सोनी एच और िंडेल एफ 2021. इन जिरो एंिी ट्यूर्रकुलर कक्रयाकलाप और चयजनत औिधीय
पौधों के अकव का भौजतक-रासायजनक मानकीकरण। इंजडयन िनलव ऑफ फामावस्ट्युरिकल साइंसेि 83: 230-237.
27. मेजर्लोकोकस कैप्सूलैिस की गणना का अिधारण -
मेजर्लोकोकस कैप्सूलैिस यह एक अजनिाय व मीर्ने ोरो़ि ह ै जिसे िृजद्ध के जलए मीर्ने (CH ) की आिश्यकता होती ह,ै यह
4
र्ैक्िीररया, नाइरेि जमनरल सॉल्ि (एनएमएस) मीजडयम म ें र्ढ़ता ह ै िर् 50% हिा : 50% CH िाले िातािरण म ें
4
इनक्यूर्ेि ककया िाता ह,ै ग्रोर् तापमान 37-40o सेजल्सयस तक होता ह।ै
27.1 उपकरण-
(क) िेइंग र्लै ेंस
(ख) पी एच मीिर
(ग) िािर र्ार्
(घ) आिोक्लेि
(ङ) हॉि एयर ओिन
(च) र्ायोसेफ्िी कैजर्नेि/लैजमनार एयर फ्लो चैंर्र
(छ) इन्द्क्यूर्ेिसव
(ज) कॉलोनी काउंिसव
27.2 ग्रोर् मीजडयम और डाइल्यएू ं्स-
(क) ग्रोर् मीजडयम: नाइरेि जमनरल साल्ि (एनएमएस) मीजडयम और अमेररकन िाइप कल्चर कलेक्िन द्वारा पररिर्तवत
और नाइरेि जमनरल साल्ि मीजडयम की संरचना जनम्नजलजखत सारणी में जनर्दष्टव ह-ै
(i) नाइरेि जमनरल सॉल्ि (एनएमएस) मीजडयम की सरं चना जनम्न सारणी म ें िर्णतव ह-ै
सारणी
क्र. स.ं सघं िक मात्रा
(i) MgSO .7H O 1.0 ग्राम
4 2
(ii) CaCl .6H O 0.20 ग्राम
2 2
(iii) *जचलेिेड आयरन सॉल्यूिन 2.0 जम.ली.
(iv) KNO 1.0 ग्राम
3
(v) **रेस एजलमेंि सॉल्यूिन 0.5 जम.ली.44 THE GAZETTE OF INDIA : EXTRAORDINARY [PART II—SEC. 3(ii)]
(vi) अगर 15.0 ग्राम
(vii) जडजस्ट्िल्ड डीआयोनाइज्ड िॉिर 1 लीिर
(viii) पीएच को समायोजित करें 6.8-7.0
*नीच े दी गई सारणी म ें जनर्दष्टव अनसु ार चले िे ेड आयरन सॉल्यिू न तयै ार ककया िाना चाजहए-
सारणी
क्र. स.ं सघं िक मात्रा
(i) फेररक (III) अमोजनयम साइरेि 0.1 ग्राम
(ii) ईडीिीए, सोजडयम सॉल्ि 0.2 ग्राम
(iii) एचसीएल (कॉन्द्सन्द्रेिेड) 0.3 जम.ली.
(iv) जडजस्ट्िल्ड डीआयोनाइज्ड िॉिर 100.0 जम.ली.
(िैकजल्पक: 0.05 ग्राम फेररक (III) क्लोराइड को सब्लसीियूि ककया िा सकता ह)ै
**नीच े दी गई सारणी म ें जनर्दष्टव अनसु ार रेस एजलमिें सॉल्यिू न तयै ार ककया िाना चाजहए-
सारणी
क्र. स.ं सघं िक मात्रा
(i) ईडीिीए 500.0(जमलीग्राम)
(ii) FeSO4 . 7H O 200.0(जमलीग्राम)
2
(iii) ZnSO . 7H O 10.0(जमलीग्राम)
4 2
(iv) MnCl . 4H O 3.0(जमलीग्राम)
2 2
(v) H BO 30.0(जमलीग्राम)
3 3
(vi) CoCl . 6H O 20.0(जमलीग्राम)
2 2
(vii) CaCl . 2H O 1.0(जमलीग्राम)
2 2
(viii) NiCl . 6H O 2.0(जमलीग्राम)
2 2
(ix) Na MoO . 2H O 3.0(जमलीग्राम)
2 4 2
(x) जडजस्ट्िल्ड िॉिर 1.0 (लीिर)
(ii) मीजडयम को 121o सेजल्सयस पर 20 जमनि के जलए आिोक्लेि करें।
(iii) आिोक्लेि के र्ाद जमलाए:ं आिोक्लेव्ड मीजडयम म ें2 जम.ली./लीिर *फॉस्ट्फेि र्फर (पीएच 6.8) जमलाएं।
* फॉस्ट्फेि र्फर, पीएच 6.8 (ग्राम/लीिर) के जलए, 1 लीिर पानी म ें3.6 ग्राम Na HPO और 1.4 ग्राम KH PO जमलाए ं
2 4 2 4
और ऑिोक्लेि करें, ऑिोक्लेव्ड फॉस्ट्फेि र्फर स्ट्िॉक घोल को 4-8o सेजल्सयस (रेकफ्रिरेिन) पर स्ट्िोर ककया िाना चाजहए।
(ख) डाइल्यएू ं्स: कफजियोलॉजिकल सलाइन (0.9% सोजडयम क्लोराइड) - 100 जम.ली. पानी म ें 0.9 ग्राम NaCl जमलाए।ं
27.3 प्रकक्रया-
(क) संरचना के अनुसार नाइरेि जमनरल साल्ि (एनएमएस) मीजडयम तैयार करें और इसे 121oसेजल्सयस पर 20 जमनि
के जलए आिोक्लेि करें;
(ख) मीजडयम को ऑिोक्लेि करन ेके र्ाद, 1 लीिर मीजडयम म ें2 जम.ली. ऑिोक्लेव्ड फॉस्ट्फेि र्फर डाल ेंऔर मीजडयम
को 45-50o सेजल्सयस तक ठंडा होने द;ें
(ग) लगभग 15-20 जम.ली. मीजडयम को पेरी प्ले्स में लेजमनार फ्लो र्ेंच म ेंडालें।[भाग II—खण्ड 3(ii)] भारत का रािपत्र : असाधारण 45
(घ) 250 जम.ली. कोजनकल फ्लास्ट्क म ें 90 जम.ली. ऑिोक्लव्े ड कफजियोलॉजिकल सलाइन म ें 10 ग्राम र्ायोजस्ट्िमुलेंि
फॉमूवलेिन डालें और िेकर पर 150 आरपीएम पर 30 जमनि तक जहलाएं, इससे सैंपल का 10-1 डाइल्यूिन जमलता
ह।ै
(ङ) कफजियोलॉजिकल सलाइन यिु 9 ट्यूर् तैयार करें और ऑिोक्लेि करें और इस े ठंडा करें।
(च) 10-1 डाइल्यूिन स े 1 जम.ली. एजलक्वॉि को 9 जम.ली. कफजियोलॉजिकल सलाइन िाली ट्यूर् म ें रांसफर करें, इसस े
10-2 डाइल्यूिन प्राप्त होता ह ै और इसी तरह 10-10 तक सीररयल डाइल्यूिन करें और हर र्ार 1 जम.ली. को 9
जम.ली. कफजियोलॉजिकल सलाइन म ेंरांसफर करें।
(छ) नाइरेि जमनरल साल्ि अगर प्लिे पर, 0.1 जम.ली. क्रम अनुसार डाइल्यूिेड सैंपल को फैलाएं और प्लेिों को 50%
हिा और 50% मीर्ेन के िातािरण म ें4-5 कदनों के जलए डेसीकेिर म ेंइनक्यूर्ेि करें, डेसीकेिर को 37±2o सेजल्सयस
पर जस्ट्र्र ककय े गए इनक्यूर्ेिर म ेंरखें।
i. 5 कदनों के र्ाद प्लेिों की िृजद्ध का जनरीक्षण करें और जनम्नजलजखत कॉलोनी आकृजत जिज्ञान को दिावने
िाली कॉलोजनयों की संख्या की गणना करें -मेजर्लोकोकस कैप्सूलैिस का ककनारा संपूणव होता ह ै और
कॉलोनी की सतह जचकनी और चमकदार कदखाई देती ह;ै
ii. कॉलोनी का आकार गोलाकार होता ह ैऔर ऊंचाई उत्तल (कॉन्द्िेक्स)होती ह;ै और
iii. सेमी-रांसलूसेंि ओपेजसिी सजहत कॉलोनी का रंग सफेद होता ह ै।
27.4 गणना-
कॉलोनी फॉर्मांग यूजनि (सीएफय ू प्रजत ग्राम) = एन x डाइल्यिू न फैक्िर x 10
[उदाहरण: 10-6 डाइल्यूिन पर 201 कॉलोजनयां कदखाई दीं, प्रजत ग्राम सीएफय ू होगा-
प्रजत ग्राम सीएफय=ू 201 x 106 x 10=2.01 x 109]
27.5 सदं भ-व
जव्हिेनर्री, आर., डेजिस, एस एल . और जिबल्कंसन, ि ेएफ. (1970) मीर्ेन का उपयोग करने िाले र्ैक्िीररया का संिधवन,
पृर्क्करण और उसके कुछ गणु । िनवल ऑफ िनरल माइक्रोर्ायोलॉिी, 61, 205–218.
28. मजेर्लोर्क्ैिीररयम बसजंर्योरिकम और मजेर्लोर्क्ैिीररयम एक्सिॉकेन्द्स की गणना का अिधारण –
28.1 उपकरण-
(क) िेइंग र्लै ेंस
(ख) पीएच मीिर
(ग) िािर र्ार्
(घ) आिोक्लेि
(ङ) हॉि एयर ओिन
(च) र्ायोसेफ्िी कैजर्नेि/लैजमनार एयर फ्लो चैंर्र
(छ) इन्द्क्यूर्ेिसव
(ज) कॉलोनी काउंिसव
28.2 ग्रोर् मीजडयम और डाइल्यएू ं्स-
(क) ग्रोर् मीजडयम: जनम्न सारणी में दी गई संरचना के अनुसार, अमोजनयम जमनरल साल्ि अगर मीजडयम तैयार करें, इस े
ऑिोक्लेि करें और 01 लीिर मीजडयम म ें 05 जम.ली. मर्े नॉल जमलाएं।
अमोजनयम जमनरल सॉल्ि (एएमएस) मीजडयम की सरं चना-
सारणी
क्र.स.ं संघिक मात्रा
(i) K HPO 0.70 ग्राम
2 4
(ii) KH PO 0.54 ग्राम
2 446 THE GAZETTE OF INDIA : EXTRAORDINARY [PART II—SEC. 3(ii)]
(iii) MgSO . 7H O 1.0 ग्राम
4 2
(iv) CaCl . 2H O 0.2 ग्राम
2 2
(v) FeSO . 7H O 4 जमली ग्राम
4 2
(vi) NH Cl 0.5 ग्राम
4
(vii) ZnSO .7 H O 0.10 जमलीग्राम
4 2
(viii) MnCl . 4H O 0.03 जमलीग्राम
2 2
(ix) H BO 0.3 जमलीग्राम
3 3
(x) CoCl . 6H O 0.2 जमलीग्राम
2 2
(xi) CuCl . 2H O 0.1 जमलीग्राम
2 2
(xii) NiCl . 6 H O 0.02 जमलीग्राम
2 2
(xiii) Na MoO . 2 H O 0.06 जमलीग्राम
2 4 2
(xiv) पीएच को 6.8 पर समायोजित करें
(ख) डाइल्यएू ंि: कफजियोलॉजिकल सलाइन (0.9% सोजडयम क्लोराइड) - 100 जम.ली. पानी म ें 0.9 ग्राम NaCl जमलाएं।
28.3 प्रकक्रया-
(क) संरचना के अनुसार एएमएस मीजडयम तैयार करें और इस े 121o सेजल्सयस पर 20 जमनि के जलए आिोक्लेि करें;
(ख) मीजडयम को ऑिोक्लेि करने के र्ाद, 1 लीिर मीजडयम म ें 5 जम.ली. मीर्ेनॉल जमलाएं और मीजडयम को 45-50
o सेजल्सयस तक ठंडा होने दें;
(ग) लगभग 15-20 जम.ली.मीजडयम को पेरी प्लेिों म ेंडालकर लेजमनार फ्लो र्ेंच म ेंडाल;ें
(घ) 250 जम.ली. कोजनकल फ्लास्ट्क म ें 90 जम.ली. ऑिोक्लव्े ड कफजियोलॉजिकल सलाइन म ें 10 ग्राम र्ायोजस्ट्िमुलेंि
फॉमूवलेिन डालें और 150 आरपीएम पर िेकर पर 30 जमनि तक जहलाएं, इससे सैंपल का 10-1 डाइल्यूिन जमलता
ह;ै
(ङ) कफजियोलॉजिकल सलाइन यिु 9 ट्यूर् तैयार करें और ऑिोक्लेि करें और इस े ठंडा करें;
(च) 10-1 डाइल्यूिन स े 1 जम.ली. एजलक्वॉि को 9 जम.ली. कफजियोलॉजिकल सलाइन िाली ट्यूर् म ें रांसफर करें, इसस े
10-2 डाइल्यूिन प्राप्त होता ह ै और इसी तरह 10-9 तक सीररयल डाइल्यूिन करें और हर र्ार 1 जम.ली. को 9
जम.ली. कफजियोलॉजिकल सलाइन म ेंरांसफर करें;
(छ) एनएमएस अगर प्लेि पर सीररयली डायलूिेड सेंपल का 0.1 जम.ली. फैलाए ं और 30±2 o सेजल्सयस पर मेंिने
ककए गए इनक्यूर्ेिर म ें इनक्यर्ू ेि करें; और
(ि) 5-8 कदनों के र्ाद प्लेिों पर िृजद्ध का जनरीक्षण करें, उन कॉलोजनयों की संख्या जगनें िो छोिी और गलु ार्ी रंग की
ह।ैं
28.4 गणना-
कॉलोनी फॉर्मांग यूजनि (सीएफय ू प्रजत ग्राम) = एन x डाइल्यिू न फैक्िर x 10
28.5 सदं भ-व
जव्हिेनर्री, आर, डेजिस, एसएल. और जिबल्कंसन, िेएफ. (1970) मीर्ेन-उपयोग करने िाले र्ैक्िीररया का संिधवन,
पृर्क्करण और गणु । िनलव ऑफ िनरल माइक्रोर्ायोलॉिी, 61, 205–218।
29. र्क्ै िीररयल कल्चस वका मॉजलक्यलू र आईडेंरिकफकेिन-
29.1 उपकरण-
(क) िािर र्ार्
(ख) रेकफ्रिरेिेड माइक्रोसेंरीफ्यूग[भाग II—खण्ड 3(ii)] भारत का रािपत्र : असाधारण 47
(ग) िोिेक्स जमक्सर
(घ) यूिी-जिज़ स्ट्पेक्रोफोिोमीिर
(ङ) र्मवल साइक्लर
(च) िेल डॉक्यूमेंिेिन जसस्ट्िम
(छ) डी.एन.ए. सीक्वेंसर
29.2 केजमकल्स और रीएििें की तयै ारी-
(क) ररस (हाइड्रोक्सीमेजर्ल) एजमनोमेर्ेन
(ख) एजर्लीनडायमीनेिेराएसेरिक एजसड (ईडीिीए)
(ग) सोजडयम डोडेजसल सल्फेि (एसडीएस)
(घ) कफनोल
(ङ) क्लोरोफाम व
(च) सोजडयम एसीिेि
(छ) इर्ेनॉल
(ि) ररस- इडीिीए (िीइ) र्फर
(झ) िैक पॉलीमरेज़
(ञ) 10एक्स िैक पॉलीमरेज़ र्फर
(ि) डीएनिीपी
(ठ) प्राइमर एफ - pA (5'-AGAGTTTGATCCTGGCTCAG-3')
(ड) प्राइमर आर - pH(5'AAGGAGGTGATCCAGCCGCA-3')
(ढ) न्द्यूजक्लअस फ्री िॉिर
(ण) 6 एक्स लोबडंग र्फर (3.4 जम.ली. जग्लसरॉल, 25 जम.ली.ग्राम िोमोफेनॉल ब्ललू, 25 जम.ली.ग्राम ज़ाइलीन साइनॉल
एफएफ और 6.7 जम.ली. जडजस्ट्िल्ड H O जमलाए)ं
2
(त) एजर्जडयम िोमाइड
(र्) अगारोज़
(द) हॉररिॉन्द्िल िले इलेक्रोफोरेजसस जसस्ट्िम
(ध) पािर पैक
(न) सीक्वेंस र्फर
(ऩ) िीआरआर - िर्मवनेिर रेडी ररएक्िन: ए, िी, सी, िी डाई िर्मवनेिर को डी-रोडामाइन डाई, डीएनिीपी, िैक
पॉलीमरेज़, MgCl और ररस-एचसीएल र्फर (पीएच - 9.0) के सार् लेर्ल ककया गया ह।ै
2
(प) लोबडंग र्फर [फॉमावमाइड: 25 mM ईडीिीए (4:1)]
(फ) जर्ग- डाई िर्मवनेिर ककि
(र्) िेल प्यूररकफकेिन ककि
29.3 प्रकक्रया
(क) िेम्पलिे डी.एन.ए. की तयै ारी
(क) अगर प्लेिों स े र्ैक्िीररया का एक लूप ल ें और 1.5 जम.ली. माइक्रो-सेंरीफ्यूग ट्यूर् म ें 0.4 जम.ली. ररस ईडीिीए
र्फर म ें सस्ट्पडें करें;
(ख) इसम ें10% एसडीएस की 40 माइक्रो लीिर जमलाएं और हल्के स ेजहलाते हुए 37o सेजल्सयस की िािर र्ार् में 30
जमनि के जलए रख;ें48 THE GAZETTE OF INDIA : EXTRAORDINARY [PART II—SEC. 3(ii)]
(ग) 0.40 जम.ली. कफनोल डालें और अच्छी तरह जमलाएँ;
(घ) इस सस्ट्पेंिन िाली ट्यूर् को 8000 आरपीएम पर 5 जमनि के जलए सेंरीफ्यूि करें;
(ङ) एक माइक्रोजपपेि की मदद स ेएक्यूअस फेि को एकत्र करें और इस े एक नई ट्यूर् म ेंस्ट्र्ानांतररत करें;
(च) एक्युअस फेि म ें 0.20 जम.ली. कफनोल और 0.20 जम.ली. क्लोरोफॉम व डालें और जर्ना िोिेबक्संग के अच्छी तरह
जमलाए;ं
(छ) सस्ट्पेंिन को 8000 आरपीएम पर 5 जमनि के जलए सेंरीफ्यूि करें;
(ि) एक्युअस फेि को एकत्र करें और इस े एक अन्द्य नई ट्यूर् म ेंस्ट्र्ानांतररत करें;
(झ) इसम ें0.4 जम.ली. क्लोरोफॉमव जमलाएं और जर्ना िोिेबक्संग के जमलाएं और 5 जमनि के जलए 8000 आरपीएम पर
सेंरीफ्यूि करें और एक्युअस फेि को एक नई ट्यूर् म ेंइकट्ठा करें;
(ञ) इसम ें 0.1 िॉल्यूम 3M सोजडयम एसीिेि डालें,पीएच 5.2 और अच्छी तरह जमला ल;ें
(ि) 96% इर्ेनॉल की 2 िॉल्यूम डालें और इस े -20o सेजल्सयस पर 1 घंिे के जलए रखें;
(ठ) सामग्री को 8000 आरपीएम पर 10 जमनि के जलए सेंरीफ्यूि करें;
(ड) सतह पर तरै ने िाला सुपरनेिेंि को छान ल,ें ट्यूर् में र्चा हुआ पेलेि डी.एन.ए. ह;ै
(ढ) डी.एन.ए. पले ेि को ठण्डे 70% इर्ने ॉल स े धो ल ेंऔर 8000 आरपीएम पर 10 जमनि के जलए सेंरीफ्यूग करें;
(ण) सतह पर तरै ने िाले सुपरनेिेंि को हिा दें;
(त) सूखे पेलेि को 40 माइक्रो लीिर िीई र्फर म ें सस्ट्पडें करें और 4o सेजल्सयस पर स्ट्िोर करें; और
(र्) 260 एनएम पर स्ट्पेक्रोफोिोमीिर का उपयोग कर डी.एन.ए. की मात्रा जनधावररत करें (1 ओडी = 50.0 एनिी
डी.एन.ए. प्रजत माइक्रो लीिर) ।
(ख) 16S rआरएनए िीन और िले इलक्े रोफोरेजसस का पीसीआर ऐंप्लीकफकेिन
(क) िीनोजमक डी.एन.ए. (50-100 नैनो ग्राम) को यूजनिसवल प्राइमसव pA (5'-AGAGTTTGATCCTGGCTCAG-
3') और pH (5' AAGGAGGTGATCCAGCCGCA -3'), र्फर, डीएनिीपी और िैक पॉलीमरेज़ के सार्
जमलाकर 16 एस आरआरएनए िीन को ऐंप्लीफाई करें;
(ख) जनम्न सारणी के अनुसार 0.2 जम.ली. पीसीआर ट्यूर् म ेंआपेजक्षत मात्रा म ेंरीएिें्स को डाल;ें
सारणी
क्र. स.ं घिक स्ट्िॉक सॉल्यिू न िर्कांग सॉल्यिू न आयतन प्रजत प्रजतकक्रया
10एक्स िैक पॉलीमरेज़
र्फर 10 एक्स 1 एक्स 5 माइक्रो लीिर
(i)
डीएनिीपी 10 mM 0.2 mM 1 माइक्रो लीिर
(ii)
प्राइमर एफ (pA) 50 pM 1.5 pM 1.5 माइक्रोलीिर
(iii)
प्राइमर आर (pH) 50 pM 1.5 pM 1.5 माइक्रोलीिर
(iv)
3 U/माइक्रो 1.5 U 0.5 माइक्रोलीिर
िैक पॉलीमरेज़ लीिर
(v)
डी.एन.ए. 4 माइक्रोलीिर
(vi)
न्द्यूजक्लअस फ्री िॉिर 36.5 माइक्रोलीिर
(vii)
कुल 50 माइक्रोलीिर
(viii)
(ग) सभी काय व र्फव पर ही करें;
(घ) सैंपल के अजतररि, संभाजित संदिू ण की िांच के जलए जनगेरिि कंरोल (अर्ावत जर्ना िेम्पलेि डी.एन.ए.) को भी
सार्-सार् र्नाए रखें;
(ङ) सभी पीसीआर ट्यूर्ों को ढक्कन लगाकर जमलाएं। ट्यूर्ों को 2-3 सेकंड के जलए माइक्रोसेंरीफ्यूग म ें घुमाए ं ताकक
नीच े की सामग्री एकजत्रत हो िाए;
(च) र्मवल साइक्लर म ें जनम्नजलजखत तापमान प्रो़िाइल के सार् डी.एन.ए. ऐंप्लीकफकेिन करें : 5 जमनि के जलए 94o
सेजल्सयस पर प्रारंजभक इन्द्क्यूर्ेिन, उसके र्ाद 35 चक्र (1 जमनि के जलए 94o सेजल्सयस, 1 जमनि के जलए 52.5o
सेजल्सयस, और 2 जमनि के जलए 72o सेजल्सयस) और र्मलव साइक्लर का उपयोग करके 10 जमनि के जलए अंजतम[भाग II—खण्ड 3(ii)] भारत का रािपत्र : असाधारण 49
जिस्ट्तार;
(छ) पीसीआर के पूरा होने के र्ाद, एक उपयुि एजलक्वॉि (2-3 माइक्रो लीिर ) को 5एक्स लोबडगं र्फर के 0.5 माइक्रो
लीिर के सार् जमलाएं और एजर्जडयम िोमाइड युि 1% एगरोज़ िले म ें लोड करें (अंजतम सांरता 0.2-0.5
जम.ग्रा./जम.ली. के सार्);
(ि) डेढ़ घंिे तक िले को 60 िोल्ि/सेमी पर चलाकर प्रिर्धवत डी.एन.ए. खंड को अलग करें और िेल डॉल्यूमेंिेिन
जसस्ट्िम का उपयोग करके यूिी प्रकाि के तहत जििुअलाइि करें।
(ग) 16S rआरएनए िीन की सीक्वेंबसगं -
(क) 16S rडीएनए खंडों के सार् िले को ठीक स े कािें और िेल स ेजनकाल लें।
(ख) ककसी भी व्यािसाजयक रूप स ेउपलब्लध पीसीआर/िले प्यूररकफकेिन ककि का उपयोग कर और जनमावता के प्रोिोकॉल
का पालन करत े हुए, डी.एन.ए. को एल्यूि करें और िुद्ध करें।
(ग) पीसीआर सीक्वेबसंग के जलए िद्धु पीसीआर उत्पाद का जनम्नजलजखत प्राइमरों के सार् उपयोग करें-
(i) 8-27एफ -5'AGAGTTTGATCCTGGCTCAG-3'
(ii) 1492 आर -5'-GGT TACCTTGTTACGACTT-3'
(घ) पीसीआर सीक्वेबसंग के जलए प्रोिोकॉल जनम्न सारणी म ें कदया गया ह ै-
सारणी
क्र. स.ं घिक स्ट्िॉक सॉल्यिू न आयतन/प्रजतकक्रया
(i) सीक्वेंस र्फर 5 एक्स 1.5 माइक्रो लीिर
(ii) प्राइमर 2 pM 1.5 माइक्रो लीिर
(iii) न्द्यूजक्लअस फ्री िॉिर 3.0 माइक्रो लीिर
(iv) डी.एन.ए. 3.0 माइक्रो लीिर
(v) िीआरआर 1.0 माइक्रो लीिर
(vi) कुल 10 माइक्रो लीिर
िीआरआर - िर्मवनेिर रेडी ररएक्िन: ए, िी, सी, िी डाई िर्मवनेिर को डी-रोडामाइन डाई, डीएनिीपी, िैक
पॉलीमरेज़, MgCl और ररस-एचसीएल र्फर (पीएच - 9.0) के सार् लेर्ल ककया गया ह।ै
2
(ङ) पीसीआर मिीन म ें 35 चक्रों के जलए चक्र सीक्वेंबसंग जनम्नजलजखत जस्ट्र्जतयों के सार् करें: 1 जमनि के जलए 96o
सेजल्सयस पर प्रारंजभक डीनैचरु ेिन, उसके र्ाद सीक्वेंबसंग के 25 चक्र और प्रत्येक चक्र म ें 30 सेकंड के जलए 96o
सेजल्सयस पर डीनैचुरेिन चरण, 15 सेकंड के जलए 52o सेजल्सयस पर एनीबलंग चरण और 4 जमनि के जलए 60o
सेजल्सयस पर जिस्ट्तार चरण िाजमल ह।ै अंत म ें4o सेजल्सयस पर प्यूररकफकेिन के जलए तैयार होने तक रखें;
(च) पीसीआर के र्ाद, उत्पादों को, 3 एम सोजडयम एसीिेि (पीएच 4.6) के 1 माइक्रोलीिर और इर्ेनॉल के 50
माइक्रोलीिर का उपयोग करके, 15 जमनि के जलए र्फव पर इनक्यूर्ेि करके प्रेजसजपिेि करें;
(छ) 4o सेजल्सयस पर 20 जमनि के जलए 15000 आरपीएम पर सेंरीफ्यूिेिन द्वारा पीलेि को पुनः प्राप्त करें, पीलेि को
70% इर्ेनॉल के सार् धो ल,ें इसे िैक्यूम के तहत सूखा लें, और 10 माइक्रो लीिर लोबडंग र्फर [फॉमावमाइड: 25
mM ईडीिीए (4: 1)] म ें जडिॉल्ि करें; और
(ज) िेनेरिक एनालाइिर का उपयोग करते हुए, 10 माइक्रो लीिर की कुल मात्रा म ेंजर्ग डाई िर्मनव ेिर सीक्वेंबसंग ककि
स े जमिण का उपयोग करके डाइजडऑक्सी चेन-िर्मवनेिन जिजध द्वारा rडी.एन.ए. सीक्वेंस का जनधावरण करें।
(घ) 16S r आरएनए िीन सीक्वेंस का उपयोग करके मॉजलक्यलू र आईडेंरिकफकेिन-
र्ैक्िीररया के पणू व लंर्ाई िाले 16S rडीएनए सीक्वेंस की तलु ना एनसीर्ीआई डेिार्ेस म ें उपलब्लध सीक्वेंस के सार्,
जनकितम िैक्सा की पहचान करने के जलए, डेिार्ेस म ें उपलब्लध ब्ललास्ट्ि सचव द्वारा की िाती ह।ै
30. कीिनािक अिििे सदं िू ण का अिधारण –
30.1 उपकरण-
(1) सेंरीफ्यूि लो-िॉल्यूम्स
(2) िीसीएमएस/एमएस (GCMS/MS)
(3) एलसीएमएस/एमएस (LCMS/MS )
(4) ऐनाजलरिकल र्लै ेंस 0.01जमलीग्राम50 THE GAZETTE OF INDIA : EXTRAORDINARY [PART II—SEC. 3(ii)]
30.2 केजमकल और रीएििें की तयै ारी-
(क) एजर्ल एसीिेि (एआर ग्रडे )
(ख) सोजडयम सल्फेि जनिलव :- 650 जडग्री सेजल्सयस पर 4 घंिे तक गम व ककया गया।
(ग) मेर्नॉल:- एलसीएमएस ग्रेड।
(घ) अमोजनयम एसीिेि एआर ग्रेड
(ङ) प्राइमरी सेकेंडरी अमीन (पीएसए)
(च) स्ट्िैंडड व तैयारी
(i) इंजडजििुअल पेजस्ट्िसाइड का स्ट्िॉक सॉल्यूिन: 10 जमलीलीिर िॉल्यूमेररक फ्लास्ट्क म ेंलगभग 10 जमलीग्राम के व्यजिगत
प्रमाजणत संदभव मानकों का ििन करें और एलसीएमएस/एमएस के जलए मेर्नॉल म ेंऔर िीसीएमएस-एमएस के
जलए एजर्ल एसीिेि म ेंघोलें। इस स्ट्िॉक घोल म ेंकीिनािक का कॉन्द्सन्द्रेिन 1000 जमलीग्राम/ककग्रा ह;ै
(ii) मध्यिती स्ट्िैंडडव सॉल्यिू न: स्ट्िॉक सॉल्यूिन (1000 जमलीग्राम/ककग्रा) स,े 10 जमलीलीिर िॉल्यूमेररक फ्लास्ट्क म ें
अपेजक्षत मात्रा को जपपेि करके 100 जमलीग्राम /ककग्रा का स्ट्िैंडडव सॉल्यिू न तैयार करें और उपयुि जिलायक
(एलसीएमएस/एमएस के जलए मेर्नॉल और िीसीएमएस/एमएस के जलए इर्ाइल एसीिेि) के सार् जनिान तक
तैयार करें;
(iii) कीिनािक मानकों का जमिण (1 माइक्रो ग्राम /जमली लीिर), प्रत्येक व्यजिगत मानक स्ट्िॉक समाधान (100
जमलीग्राम/ककग्रा) स,े स्ट्िैंडडव सॉल्यूिन की अपेजक्षत मात्रा को 25 जमलीलीिर /50 जमलीलीिर /100 जमलीलीिर
िॉल्यूमेररक फ्लास्ट्क म ें जपपेि करें, जिससे 1.0 जमलीग्राम /जमलीलीिर कॉन्द्सन्द्रेिन िाले कीिनािकों का जमिण
तैयार हो सके; और
(iv) लीजनयर डाल्यिू न्द्स की तयै ारी, जिजभन्न 5 स्ट्तरों के डाइल्यूिन के जलए चरण (iii) स ेस्ट्िॉक जिलयन की अपेजक्षत मात्रा
5 जमलीलीिर िॉल्यूमेररक फ्लास्ट्क म ें जपपेि करें तर्ा उपयुि जिलायक के सार् जनिान तक तयै ार करें।
30.3 प्रकक्रया-
30.3.1. एलसीएमएस/एमएस जनष्किणव के जलए-
(i) सैंपल का ििन: 15 जमलीलीिर सेंरीफ्यूि ट्यूर् म ें1 ग्राम सैंपल का ििन करें, सैंपल म ें10 जमलीलीिर मर्े नॉल
जमलाएं, सैंपल को 30 सेकंड के जलए िोर स ेजहलाएं और 30 सके ंड के जलए िोिेक्स करें और सपैं ल को 10 जमनि
के जलए सोजनकेि करें;
(ii) डाइल्यूिन-1: चरण (i) स े 1 जमलीलीिर एक्सरैक्ि को जपपेि द्वारा 10 जमलीलीिर मानक िॉल्यूमेररक फ्लास्ट्क
म ें डाल ें तर्ा मर्े नॉल और पानी (50:50) का उपयोग करके मात्रा को जनिान तक पूरा करें;
(iii) सफाई: 2 जमलीलीिर माइक्रो सेंरीफ्यूि ट्यूर् म ें 25 जमलीग्राम प्राइमरी सेकेंडरी अमीन (पीएसए) डालें और
1.0 जमलीलीिर सैंपल एक्सरैक्ि जपपेि स े र्ाहर जनकाल ें और 30 सेकंड के जलए िोिेक्स करें ;
(iv) लो िॉल्यूम सेंरीफ्यगू ेिन: सैंपल को -10° सेजल्सयस पर 10000 आरपीएम पर 5.0 जमनि के जलए रेकफ्रिरेिेड
सेंरीफ्यूग म ेंसेंरीफ्यूि करें;
(v) कफल्रेिन: सेंरीफ्यगू ेिन के र्ाद सतह पर तरै ने िाला सुपरिेन्द्ि लें और सुपरिेन्द्ि को 0.2 माइक्रोन मेंिेन कफल्िर
के माध्यम स े 2 जमलीलीिर ग्लास िायल म ेंछान ल;ें और
(vi) सैंपल इंिेक्िन: सारणी-1 म ें दी गई क्रोमैिोग्राकफक जस्ट्र्जत का उपयोग करके एलसीएमएस/एमएस में 5
माइक्रोलीिर क़िल्रेि इंिेक्ि करें।
30.3.2 िीसीएमएस/एमएस जनष्किणव के जलए-
(i) 15 जमलीलीिर ट्यूर् म ें1 ग्राम सैंपल का ििन करें, सैंपल म ें 10 जमलीलीिर एजर्ल एसीिेि जमलाएं, सैंपल के
घोल को 30 सेकंड के जलए िोर स ेजहलाए ं, 30 सेकंड के जलए िोिेक्स म ेंघुमाएं और 10 जमनि के जलए सोजनकेि
करें;
(ii) डाइल्यूिन-1: चरण (i) स े 1 जमलीलीिर एक्सरैक्ि को जपपेि द्वारा 10 जमलीलीिर स्ट्िैंडडव िॉल्यूमेररक फ्लास्ट्क
म ें डाल ें तर्ा एजर्ल एसीिेि स ेमात्रा को जनिान तक पूरा डाल;ें
(iii) सफाई: 1 जमलीलीिर सैंपल एक्सरैक्ि को जपपेि स ेर्ाहर जनकालें, 2 जमलीलीिर सेंरीफ्यगू ट्यूर् म ें25 जमलीग्राम
प्राइमरी सेकंड्री अमीन (पीएसए) और 150 जमलीग्राम Na SO डालें और 30 सेकंड के जलए िोिेक्स करें;
2 4[भाग II—खण्ड 3(ii)] भारत का रािपत्र : असाधारण 51
(iv) सेंरीफ्यूगेिन: सैंपल को -10° सेजल्सयस पर 10000 आरपीएम पर 5.0 जमनि के जलए रेकफ्रिरेिेड सेंरीफ्यगू म ें
सेंरीफ्यूग करें;
(v) कफल्रेिन: सेंरीफ्यगू ेिन के र्ाद सतह पर तरै ने िाले सुपरनिे ेंि को ल ें और सुपरनेिेंि को 0.2माइक्रोन मेंिेन
कफल्िर के माध्यम स े 2 जमलीलीिर िीसी िायल म ेंछान ल;ें और
(vi) सैंपल इंिेक्िन: सारणी -2 म ें दी गई क्रोमैिोग्राकफक जस्ट्र्जत का उपयोग करके िीसीएमएस/एमएस म ें 1
माइक्रोलीिर कफल्रेि इंिेक्ि करें।
30.3.3 इंिक्े िन का अनक्रु म-
(क) रीएिेंि ब्ललैंक इनिेक्ि करें
(ख) कैजलिेिन रेंि के भीतर उपयिु कॉन्द्सन्द्रेिन का एक स्ट्िैंडड व इंिक्े ि करें
(ग) रीएिेंि ब्ललैंक इनिेक्ि करें
(घ) सैंपल इंिेक्ि करें
(ङ) प्रत्येक छह सैंपल के र्ाद कैजलििे न रेंि के भीतर उपयिु कॉन्द्सन्द्रेिन का एक स्ट्िैंडड व इंिेक्ि करें
30.4 गणना-
सैंपल का मानक की
एररया सान्द्रता
डीएफ
कीिनािक की सांरता(कॉन्द्सन्द्रेिन) (%) = x x
स्ट्िैंडड व का सैंपल का ििन 104
एररया
िहा,ँ
डीएफ = डाइल्यूिन फैक्िर=100 ह।ै
सारणी -1
एलसी- एमएस-एमएस जस्ट्र्जत
कॉलम Acquity UPLC®BEH-सी 18,1.7 माइक्रोन [100 जममी]
मोर्ाइल फेज़ ए: 10mM अमोजनयम एसीिेि और 0.1% फॉर्मवक एजसड युि पानी :
मेर्नॉल (98:2)
मोर्ाइल फेज़
मोर्ाइल फेज़ र्ी: 0.1% फॉर्मकव एजसड के सार् मर्े नॉल
फ्लो रेि 0.350 जम.ली./जमनि
मोर्ाइल फेि प्रोग्राबमगं
समय प्रिाह
(जमलीलीिर/जमनि)
(100 जममी कॉलम) % ए % र्ी कि व
प्रारंजभक 0.350 95.0 5.0 प्रारंजभक
0.25 0.350 95.0 5.0 6
5.00 0.350 50.0 50.0 6
10.00 0.350 37.5 62.5 6
10.05 0.350 20.0 80.0 6
13.00 0.350 20.0 80.0 6
16.00 0.350 5.00 95.0 6
17.50 0.350 95.0 5.0 6
22.00 0.350 95.0 5.0 652 THE GAZETTE OF INDIA : EXTRAORDINARY [PART II—SEC. 3(ii)]
एमएस-एमएस जस्ट्र्जत
स्रोत तापमान जिघिन कैजपलरी िोल्िेि(kV) जिघिन गैस कोन गैस प्रिाह
(जडग्री सेजल्सयस) तापमान प्रिाह (लीिर/घंिा)
आरएफ लेंस [V]
(लीिर/घंिा)
(जडग्री सेजल्सयस )
120 350 3.0 0.1 1000 50
एलसी-एमएस-एमएस पर जिश्लजे ित ककये िाने िाले कीिनािकों की सूची
क्र. स.ं कीिनािक का नाम परै ेंि आयन क्वारं िफायर आयन क्वालीफायर आयन
(क्य ू1) (क्य ू2) (क्य ू3)
(1) 6-र्ेंजज़ल एडेजनन 226.01 90.95 65.01
(2) एर्ामेजक्िन 890.34 567.31 305.26
(3) एसीफेि 184.1 143.0 125.1
(4) एसीिाजमजप्रड 223.0 126.0 56.1
(5) एज़ोक्सीस्ट्रोजर्न 404.0 372.0 329.0
(6) एल्डीकार्व 191.1 116.0 89.0
(7) अमेररन 228.0 68.0 95.9
(8) र्ेंजडयोकार्व 224.1 167.0 109.0
(9) र्ेऩिुराकार्व 411.2 195.0 252.0
(10) र्ेन्द् सल्फ्यूरॉन-जमर्ाइल 411.0 149.0 182.0
(11) जर्ि रिेनॉल 338.1 99.1 70.1
(12) र्ुप्र ोफेजज़न 306.1 201.0 57.4
(13) का र्ेररल 202.0 145.0 117.0
(14) का र्ेंडाजिम 192.1 160.1 132.1
(15) का र्ोफ्यूरान 222.1 165.1 123.0
(16) का र्ोफ्यूरान-3- हाइड्रॉक्सी 238.0 163.0 181.0
(17) का र्ोजक्सन 236.0 143.0 87.0
(18) का फेंरािोन एजर्ल 414.0 368.0 348.0
(19) कैप्र ोपाजमड 334.0 139.0 195.9
(20) क्ल ोरएंराजनजलप्रोल े 481.8 111.8 283.6
(21) क्ल ोरमेक्वाि क्लोराइड 122.2 62.9 59.1
(22) क्ल ोरोप्रोफाम 214.1 172.0 154.0
(23) क्ल ोजर्याजनजडन 250.0 169.0 132.0
(24) जस मोक्साजनल 199.0 128.0 111.0
(25) सा इप्रोकोनाज़ोल 292.0 70.0 124.9
(26) डाइ फेंजर्यूरॉन 385.3 278.3 329.2
(27) जडफ ेनकोनाज़ोल 406.0 251.1 111.1
(28) डाइ मेर्ोएि 230.1 199.0 125.0[भाग II—खण्ड 3(ii)] भारत का रािपत्र : असाधारण 53
क्र. स.ं कीिनािक का नाम परै ेंि आयन क्वारं िफायर आयन क्वालीफायर आयन
(क्य ू1) (क्य ू2) (क्य ू3)
(29) डाई मीर्ोमॉफव 388.1 301.0 165.0
(30) डाइ नोिेफ्यूरान 203.0 129.0 113.0
(31) इम ामेजक्िन र्ेंिोएि 886.6 158.0 126.0
(32) एज र्प्रोल 398.93 256.9 352.9
(33) इर् ोक्सीसल्फ्यूरॉन 398.9 261.0 218.0
(34) फेन ाजमडोन 312.1 92.0 236.1
(35) फेन ाज़ाकक्वन 307.1 57.0 161.0
(36) फेन ोर्ुकार्व 208.0 94.9 152.0
(37) फेन ोक्साप्रोप-एजर्ल 362.1 288.0 121.1
(38) फ्ल ोजनकैमाइड 230.0 202.9 173.9
(39) फ्ल ओू जपराम 397.1 173.0 208.0
(40) फेन पायरोजक्समेि 422.2 366.1 138.1
(41) फ्ल ुर्ेंजडयामाइड 680.9 253.9 273.8
(42) फ्ल ूफेनोक्सुरोन 489.1 158.0 141.0
(43) फ़्ल ुजसलाज़ोल 316.0 247.0 165.0
(44) हक्े साजज़नोन 253.0 171.1 71.0
(45) हक्े सीजर्याज़ॉक्स 353.0 168.1 228.1
(46) इजम डैक्लोजप्रड 256.1 175.1 209.1
(47) इंड ोक्साकार्व 528.0 150.0 203.0
(48) इप्र ोिाजलकार्व 321.1 119.0 203.1
(49) आ इसोप्रोिूरॉन 207.1 72.0 46.0
(50) जल नुरोन 249.1 160.1 181.1
(51) ल्य ूफेन्द्यूरॉन 508.9 338.8 174.8
(52) मा लाऑक्सन 315.2 99.0 127.0
(53) मेल ाजर्यान 331.0 99.0 127.0
(54) मैन्द् डीप्रोपाजमड 412.0 327.9 124.8
(55) मेज पक्वािक्लोराइड 114.2 58.0 98.0
(56) मेि ालैजक्सल 280.1 220.1 192.1
(57) मेर् ाजमडाफोस 141.9 94.0 110.0
(58) मेर् ोमाइल 163.0 88.0 64.9
(59) मेि ोलाक्लोर 284.1 252.1 176.1
(60) मेर रब्लयुजज़न 215.0 89.1 131.0
(61) मो नोक्रोिोफॉस 224.1 127.1 98.1
(62) मा इक्लोर्ुिाजनल 289.1 70.2 125.0
(63) नोि ालुरोन 492.9 157.9 140.954 THE GAZETTE OF INDIA : EXTRAORDINARY [PART II—SEC. 3(ii)]
क्र. स.ं कीिनािक का नाम परै ेंि आयन क्वारं िफायर आयन क्वालीफायर आयन
(क्य ू1) (क्य ू2) (क्य ू3)
(64) ओ मेर्ोएि 214.1 125.1 183.1
(65) ऑ क्साजडयाज़ोन 247.1 169.0 109.0
(66) पैक् लोर्ुराज़ोल 294.0 69.9 124.8
(67) पेन्द् कोनाज़ोल 284.0 70.1 159.0
(68) पेन्द् सीकुरोन 329.1 125.1 124.9
(69) फॉ स्ट्मेि 317.9 160.0 77.0
(70) फॉ स्ट्फोजमडोन 300.1 127.1 174.1
(71) प्रीर िलाक्लोर 312.1 252.1 176.1
(72) प्रोप ेजनल 217.9 161.9 127.0
(73) प्रोज पकोनाज़ोल 342.0 69.0 159.0
(74) पाय रीप्रॉक्सीफेन 322.1 96.0 227.1
(75) जस माज़ीन 202.0 124.0 96.0
(76) जस्ट्प नेिोरम 748.3 142.1 98.0
(77) जस्ट्प नोसैडA 732.6 142.0 98.0
(78) जस्ट्प नोसैड-डी 732.6 142.0 98.1
(79) जस्ट्प रोिेरामेि 371.1 216.1 302.1
(80) िेर् ुकोनाज़ोल 308.0 70.1 125.0
(81) िेर ाक्लोरजिनफोस 366.85 126.92 240.78
(82) िेर ाकोनाज़ोल 372.0 159.0 70.1
(83) जर् याक्लोजप्रड 253.0 126.0 90.1
(84) जर् यामेर्ाक्सम 292.0 211.2 132.0
(85) जर् योर्ेनकार्व 258.0 125.0 100.0
(86) र्ा योडाइकार्व 355.0 87.9 107.9
(87) जर् योफैनेिजमर्ाइल 343.0 151.0 93.0
(88) िोल् ़िेनपाइराड 384.0 91.0 197.1
(89) राय डीमेफोन 294.1 69.3 197.2
(90) राय जडमेनोल 296.1 70.2 99.1
(91) राइ डेमॉफव 257.0 109.0 79.0
(92) राइ साइक्लाज़ोल 190.0 163.0 136.0
(93) राइ फ्लोक्सीस्ट्रोजर्न 409.0 186.0 145.0
सारणी -2 (िीसी जस्ट्र्जत )
ओिन तापमान दर/जमनि तापमान होल्ड का समय (जमनि)
प्रोग्राम
0.0 700 सेजल्सयस 1.0
700 सेजल्सयस 1800 सेजल्सयस 3.0[भाग II—खण्ड 3(ii)] भारत का रािपत्र : असाधारण 55
200 सेजल्सयस 2200 सेजल्सयस 9.0
80 सेजल्सयस 2800 सेजल्सयस 9.0
इंिेक्िर तापमान दर/जमनि तापमान होल्ड का समय (जमनि)
प्रोग्राम
0.0 750 सेजल्सयस 0.1
4500सेजल्सयस 3250 सेजल्सयस 5.0
100सेजल्सयस 2500 सेजल्सयस 0.0
कॉलम डीर्ीपी -5MS, 30m, 0.25एम एम ,0.5 माइक्रोन
कॉलम फ्लो 1.7 जमलीलीिर/जमनि
रांसफर लाइन 2800 सेजल्सयस
तापमान
मास रेंि 50 स े 600
एमएस जस्ट्र्जतया ं
सोसव का तापमान एमएस1 क्वाड. एमएस2 क्वाड. तापमान कोजलिन फ्लो क्वेंच फ्लो
तापमान
2900 सेजल्सयस 1500 सेजल्सयस 1500 सेजल्सयस 1.5 जमलीलीिर 2.5 जमलीलीिर /जमनि
/जमनि
िीसीएमएस पर जिश्लजे ित ककय ेिान ेिाल ेकीिनािकों की सचू ी
क्र.स.ं कीिनािक का नाम परै ेंि आयन क्वारं िफायर आयन क्वालीफायर आयन
(क्य ू1) (क्य ू2) (क्य ू3)
(1) 2 4 डीडीिी 234.7 165 199
(2) 44 डीडीडी 234.8 165 199
(3) 44 डीडीई 245.7 176 211
(4) 44डीडीिी 234.7 165 199
(5) 2,4,डीडीडी 235 199 165
(6) 2,4 डीडीई 245.8 211 175.6
(7) अलाक्लोर 187.8 160 131
(8) एजल्ड्रन 262.6 192.8 191
(9) एलेजथ्रन 122.7 81.1 79.1
(10) अल् फा एचसीएच 180.8 109 111
(11) अज नलोफोस 225.5 184 15756 THE GAZETTE OF INDIA : EXTRAORDINARY [PART II—SEC. 3(ii)]
क्र.स.ं कीिनािक का नाम परै ेंि आयन क्वारं िफायर आयन क्वालीफायर आयन
(क्य ू1) (क्य ू2) (क्य ू3)
(12) ऐर ाजिन 214.8 58 200
(13) र्ीि ा- एचसीएच 180.8 145 109
(14) जर्फ ेनाज़ेि 299.7 214.1 199
(15) र्ाइ फेनजथ्रन 180.8 165 166
(16) र्ोस्ट् काजलड 140 112 76
(17) िोम ुकोनाज़ोल 172.8 145 109
(18) ब्लय ूिाक्लोर 175.8 147 134
(19) कैप् िन 79 51 77
(20) क्ल ोरोर्ेजन्द्ज़लेि 251.1 139.1 75.1
(21) क्ल ोरफेनजिनफोस 266.7 159 81
(22) क्ल ोरपायरीफोस 213.6 258 286
(23) क्ल ोरपायरीफोस जमर्ाइल 285.7 93 271
(24) क्ल ोमाज़ोन 124.5 99 88.1
(25) सा इफ्लुजथ्रन 162.8 127 109
(26) सा इपरमेजथ्रन 180.7 152 127
(27) सा इपरमेजथ्रन अल्फा 180.7 152 127
(28) डेल् िा एचसीएच 218.8 183 147
(29) डेल् िामेजथ्रन 252.8 73 174
(30) जडक ोफोल 138.9 111 75
(31) जडक् लोरोिोस 184.8 93 109
(32) डाय जिनोन 303.8 179 166.7
(33) डाइ लजड्रन 262.7 193 191
(34) जडफ् लुर्ेनज़ऱु ोन 156.9 141.1 113.1
(35) डाइ मेफ्लुजथ्रन 122.8 80.9 67
(36) डाइ मेर्ोएि 124.9 47 79[भाग II—खण्ड 3(ii)] भारत का रािपत्र : असाधारण 57
क्र.स.ं कीिनािक का नाम परै ेंि आयन क्वारं िफायर आयन क्वालीफायर आयन
(क्य ू1) (क्य ू2) (क्य ू3)
(37) जडफ् लुफेजनकन 265.8 246.1 238
(38) एज डफेनफोस 173 109 65
(39) एंड ोसल्फान-अल्फा 240.7 206 204
(40) एंड ोसल्फान-र्ीिा 240.7 205.8 169.8
(41) एंड ोसल्फानसल्फेि 271.6 236.8 234.7
(42) एज न्द्ड्रन 263 193 191
(43) एप ॉक्सीकोनाज़ोल 192 138 111
(44) एज र्ओन 230.7 129 175
(45) एर् ोफेनप्रॉक्स 163 107.1 135.1
(46) इर् ोफ्यूमसेि 285.9 179 161
(47) इि ोक्साज़ोल 141 113 63.1
(48) फेज नरोजर्योन 276.7 260 125
(49) फेन प्रोपेजथ्रन 180.8 152 127
(50) फेज न्द्र्यन 124.8 79 47
(51) फेन िेलरेि 166.9 125 89
(52) फ्ल ुिैजलनेि 249.7 55 208
(53) क़ि प्रोजनलसुल्फोन 212.7 178 143
(54) क़ि प्रोजनल 366.6 254.9 212.9
(55) फ्ल ोराक्सी1जमर्ाइलहप्े िाइल 208.9 181 160.9
एस्ट्िर
(56) फ्ल ूजि़िॉपपीब्लयूिाइल 281.8 238.1 91
(57) फ्ल ूक्लोराजलन 306 264 206
(58) फ्ल ूफेनासेि 150.8 136.1 95
(59) गाम ा एचसीएच/बलंडेन 180.8 145 109
(60) हप्े ि ाक्लोर 271.6 236.8 235
(61) हक्े साकोनाज़ोल 213.7 159 18758 THE GAZETTE OF INDIA : EXTRAORDINARY [PART II—SEC. 3(ii)]
क्र.स.ं कीिनािक का नाम परै ेंि आयन क्वारं िफायर आयन क्वालीफायर आयन
(क्य ू1) (क्य ू2) (क्य ू3)
(62) आइ सोप्रोजर्ओलेन 289.7 204 118
(63) लैम् ब्लडासाइहले ोजथ्रन 180.8 152 127
(64) मेप रफ्लुजथ्रन 162.8 126.8 90.9
(65) जम र्ाइलपैराजर्योन 263 109 246
(66) पैर ाजर्योनएजर्ल 290.9 109 81
(67) पेंजड मेर्ाजलन 252.1 162.1 191
(68) पम ेजथ्रन 182.8 168 153
(69) कफ नोल4-िोमो-2- 207.8 63 98.9
क्लोरो-
(70) फेन्द् र्ोएि 273.7 125 121
(71) फो रेिसल्फोन 199 152.9 97
(72) फो रेिसल्फॉक्साइड 152.9 125 97
(73) फो रेि 75 47 41
(74) फो सालोन 181.8 111 75
(75) जपर रजमफोसमेजर्ल 304.7 290.1 276
(76) प्रोज समीडोन 283 255 96
(77) प्रोफ ेनोफोस 337 267 309
(78) प्रोप ेकक्वज़ा़िॉप 299 255 91
(79) कक्व नालफोस 156.8 102 77
(80) कक्व ज़ालोफोएजर्ल 298.8 255.3 192.2
(81) िेर् ुफेनपाइराड 318.1 145.1 131.1
(82) रांस फ्लुजथ्रन 162.8 143 91
(83) राय िोफॉस 160.9 134 106
(84) राइ फ्लुराजलन 263 159.9 148[भाग II—खण्ड 3(ii)] भारत का रािपत्र : असाधारण 59
31. कैडजमयम, कॉपर, क्रोजमयम, लडे और बिकं का अिधारण –
अनुसूची-IV, भाग-घ म ें क्रम संख्या 10 के अनुसार ।
32. आसजे नक का अिधारण -
अनुसूची-IV, भाग-घ म ें क्रम संख्या 12 के अनुसार”
[फा.सं. 7-38/2024(फिव लॉ/र्ीएससी]
फ्रैंकजलन एल खोर्ुंग, संयुि सजचि
रिप्पण: मूल आदेि, भारत के रािपत्र म ेंसा. का. जन. संख्या 758 (अ), तारीख 25 जसतंर्र, 1985 प्रकाजित ककया गया र्ा
और अंजतम र्ार अजधसूचना सख्ं या का. आ. 2346 (अ) तारीख 26 मई, 2025 द्वारा संिोजधत ककया गया र्ा।
MINISTRY OF AGRICULTURE AND FARMERS WELFARE
(Department of Agriculture and Farmers Welfare)
ORDER
New Delhi, the 9th June, 2025
S.O. 2539(E).— In exercise of the powers conferred by section 3 of the Essential Commodities
Act, 1955 (10 of 1955), the Central Government hereby makes the following Order further to amend the
Fertiliser (Inorganic, Organic or Mixed) (Control) Order, 1985, namely:-
1. (1) This Order may be called the Fertiliser (Inorganic, Organic or Mixed) (Control) Fifth Amendment
Order, 2025.
(2) It shall come into force on the date of its publication in the Official Gazette.
2. In the Fertiliser (Inorganic, Organic or Mixed) (Control) Order, 1985, (hereinafter referred to as the said
Order), in clause 20C, in sub-clause (3), for item B, the following items shall be substituted, namely:-
“B. Bio-efficacy Trials:
1. Agronomic Bio-efficacy trials shall be conducted at the National Agricultural Research
System, including the Indian Council of Agricultural Research and State Agricultural
Universities.
2. Bio-efficacy trials to be conducted on same crop at minimum three different doses for one
season at three agro-ecological locations.”
3. In the said Order, in Schedule VI,-
(i) for Part D, the following Part shall be substituted, namely:-
“Part-D
METHODOLOGY OF TESTING
1. Estimation of pH.-
As mentioned in the Schedule –IV, Part-D at serial number 1
2. Estimation of specific gravity.-
As mentioned in the Schedule- II, Part-B at serial number 21
3. Estimation of bulk density.-
As mentioned in the Schedule –IV, Part-D at serial number 2
4. Estimation of organic matter and organic carbon.-
As mentioned in the Schedule –IV, Part-D at serial number 5
5. Estimation of water solubility-60 THE GAZETTE OF INDIA : EXTRAORDINARY [PART II—SEC. 3(ii)]
5.1 Equipment-
a. analytical balance.
b. rotatory evaporator or hot air oven or hot plate.
c. magnetic stirrer with temperature control.
d. constant temperature water bath.
e. whatman grade 934-AH RTU glass microfiber filters.
5.2 Procedure.-
(i) take the test item in different quantity form lower to higher amount in fixed volume of water (eg.100
ml);
(ii) visually determine the saturation of solution and record the amount required to saturate the taken
water volume;
(iii) weigh excess quantity of test sample (gram) (about five times quantity of test substance required to
saturate the water) into each of three glass vessels fitted with glass stoppers (conical flasks);
(iv) take the volume of water as taken in preliminary test (e.g 100 ml) and add to each glass vessel and
tightly stopper the glass vessel and then agitate one of the vessels at 30 °C in water bath or on
magnetic stirrer for twenty four hours;
(v) equilibrate the other two vessels at 30 °C for another forty eight hours and seventy two hours
respectively;
(vi) after twenty hours, equilibrate one of the vessels for twenty four hours at 20 ± 0.5 °C with occasional
shaking;
(vii) after twenty four hours equilibration, filter the solution under vacuum using whatman grade 934-AH
RTU glass microfiber filters or 0.45µ membrane filters;
(viii) take the filtrate in round bottom flask and evaporate under vacuum up to the dryness using rotatory
evaporator with the water bath set at 60oC. (Hot plate or hot air oven can also be used as alternate to
rotary evaporator);
(ix) carefully collect the residue after evaporation (if required dry the residue at room temperature) and
record the mass of the residue using the analytical balance;
(x) additionally equilibrate the other two vessels already equilibrated at 30 °C for forty eight hours and
seventy two hours, respectively for twenty four hours at 20 ± 0.5 °C with occasional shaking and
record the mass of the residue as per the procedure mentioned in above point; and
(xi) the measured mass of residue in at least the two last vessels do not differ by more than 15%, then
consider it satisfactory and the results from vessels 1, 2 and 3 show a tendency of increasing values,
the whole test shall be repeated using longer equilibration times.
5.3 Calculations.-
Calculate water solubility % w/w by formula as given below:-
Mass of the residue obtained (gram)
Water solubility % w/w = x 100
Mass of the test substance taken (gram)
6. Estimation of total dissolved solids (TDS) or total soluble solid (TSS). -
6.1 Equipment-
a. rotary evaporator or hot plate.
b. analytical balance.
c. vortex mixture.
6.2 Procedure.-
(i) take 100 ml of the liquid sample in a pre-weighted 500 ml glass beaker (W1).
(ii) heat it at temperature of 60oC using either rotary evaporator or at 103oC using hot plate.
(iii) after complete evaporation of the solvent till the constant weight is achieved, record the weight
of the beaker (W2).
6.3 Calculation.-
TDS or TSS (gram / 100 ml) = W2- W1[भाग II—खण्ड 3(ii)] भारत का रािपत्र : असाधारण 61
7. Detection and quantification of alginic acid.-
7.1 Equipment.-
(a) HPLC-RID system.
(b) analytical balance.
(c) 0.45µ syringe filter.
(d) high speed centrifuge.
(e) vortex mixer.
7.2 Chemicals and Reagent preparation.-
(a) Sodium alginate (CAS No. 9005-38-3).
(b) Ultra pure water.
(c) standard preparation-
(i) prepare a series of sodium alginate standards in ultrapure water (5 ppm to 500 mg / ml);
(ii) Sodium Alginate stock standard solution: weigh about 10 mg of Sodium alginate in 10 ml
volumetric flask and dilute it with 10 ml ultrapure water and it gives a stock solution of 1000
mg / ml;
(iii) Sodium alginate intermediate standard solution: Dilute 1.0 ml stock standard to 10 ml with
ultrapure water and mix well and it gives an intermediate standard solution of 100 mg /ml;
(iv) dilute 1.0 ml of intermediate standard solution to 10 ml ultrapure water and it gives an
intermediate standard solution of 10 mg /ml; and
(v) prepare linearity point on the basis of sample concentration as given in the table bellow:-
Table
S. No. Linearity Conc. of Volume (ml) Volume Concentration
Standard Stock of stock (ml) of of standard
solution solution to be water to be (mg/ml)
(mg/ml) used used
(i) Standard 1 10 0.50 0.50 5
(ii) Standard 2 100 0.25 0.75 25
(iii) Standard 3 100 0.50 0.50 50
(iv) Standard 4 100 1.00 0.00 100
(v) Standard 5 1000 0.20 0.80 200
(vi) Standard 6 1000 0.30 0.70 300
(vii) Standard 7 1000 0.40 0.60 400
(viii) Standard 8 1000 0.50 0.50 500
(d) Sample preparation
(i) vortex the formulation to be tested before preparing the samples;
(ii) for solid samples, the sample need to be vortexed with ultrapure water (1:20 w/v) and to be kept
at room temperature for twelve hours followed by vigorous shaking and centrifugation;
(iii) dilute the formulation (around 50 to 100 times) taking into consideration the theoretical expected
values of alginate in the formulation under analysis; and
(iv) the samples shall be prepared as such that it falls under the standard curve concentrations of
individual standards (Alginate) and filter each sample with 0.45µ syringe filter and fill it in 2 ml
HPLC glass sample vials.
7.3 Procedure.-
(i) inject separately equal volumes (50 ml) of standard preparations and sample preparations in the
HPLC-RID system;
(ii) record the chromatograms and measure the peak response of standard preparations;
(iii) calculate the quantity of the desired compound with respect to the peak response for the
individual standard; and62 THE GAZETTE OF INDIA : EXTRAORDINARY [PART II—SEC. 3(ii)]
(iv) use the following Chromatographic conditions for analysis as specified in table below:-
Table
(i) C olumn Rezex RHM Monosaccharide H + LC Column (300
mm x 7.8 mm)
(ii) C olumn Temperature 65°C
(iii) D etector Refractive Index Detector
(iv) D etector Temperature 50°C
(v) P ump mode Isocratic
(vi) M obile Phase 0.05% acetic acid
(vii) I njection Volume 50 µl
(viii) S ignal Acquisition: Positive Polarity Mode
(ix) F low rate 0.5 ml/min
7.4 Calculations.-
Plot the standard curve with standard solutions taking concentrations along the X-axis and Area along
the Y-axis and determine the concentration of alginate present in the test samples from the standard
curve using Linear regression equation.
y= mx +b
where y is the value of second data set (peak area)
x is the value of first day set (Concentration of standard)
m is the slope of the line
b is y-intercept of the line
Slope and intercept can be calculated using the formula.-
n∑xy- (∑x)(∑y)
m (slope) =
n∑x2- (∑x)2
(∑y) ∑x2 - ∑x∑xy
b (intercept)=
n ∑x2- (∑x)2[भाग II—खण्ड 3(ii)] भारत का रािपत्र : असाधारण 63
Example.-
x 2 4 6 8
y 3 7 5 10
Construct the following table-
x y x2 xy
2 3 4 6
4 7 16 28
6 5 36 30
8 10 64 80
∑x= 20 ∑y= 25 ∑x2= 120 ∑xy= 144
m (slope) = 4(144) - 20 x 25/ 4(120) – 400 = 0.95
b (intercept)= 25 x 120 – 20 x 144/ 4(120)- 400 = 1.5
Equation for linear regression is
y= mx+b
y= 0.95 x + 1.5
7.5 Reference.-
Valverde S, Hernández-Apaolaza L, Lucena JJ 2022. A Simple Analytical Method to Determine
Alginic Acid, Laminarin and Mannitol and Seaweed Extracts Fertilisers, Journal of Chromatography
and Separation Techniques Volume-13, Issue 1 No: 1000470.
8. Estimation of carrageenan.-
8.1 Equipment.-
(a) spectrophotometer.
(b) analytical balance.
(c) vortex mixer.
8.2 Chemicals and Reagent preparation.--
(a) Toluidine Blue-O (CAS No.: 92-31-9).
(b) κ-Carrageenan standard: (CAS No.: 11114-20-8).
(c) Ultra pure water.
(d) Reagent A: 0.06 M Toluidine Blue O (TBO) solution.
(i) prepare a stock solution of TBO at a concentration of 2 mM in water (6 mg in 10 ml water)
and vortex for three to five minutes for uniform mixing; and
(ii) dilute it to the concentration of 0.06mM, by adding 0.6ml of the 2 mM TBO stock solution
to 19.4 ml water.
(e) Reagent B: stock solution (2 mg/ml) of Carrageenan.
(vi) use -Carrageenan, a sulphated polysaccharide as standard;
(vii) take 10 ml volumetric flask;
(viii) weigh 20 mg of Carrageenan and transfer it to 10 ml standard flask;
(ix) add 5-6 ml water to the standard flask and dissolve the carrageenan and vortex for 3-5 min
for uniform mixing; and
(x) Make up the final volume to 10 ml using water and mix well for homogeneity.
(f) Reagent C: Working solution (0.04 mg/ml) of Carrageenan
iii) take 10 ml volumetric flask; and
iv) add 200 μl of reagent B in standard flask and make up the final volume to 10 ml using water
and mix well for homogeneity.64 THE GAZETTE OF INDIA : EXTRAORDINARY [PART II—SEC. 3(ii)]
Note: The Toluidine blue O reagent and standard solution shall be prepared fresh before
initiating each experiment.
(g) preparation of standard solution: prepare a series of carrageenan standard solutions (in glass
test tubes) of concentrations, 0 (blank, distilled water), 0.008, 0.016, 0.024,0.032 and 0.040 mg/ml
by mixing the carrageenan working solution (Reagent C) and water as specified in the following
table –
Table
S. No. Reagent C Water Carageenan concentration
(ml) (ml) (mg/ml)
(i) 0 300 0
(ii) 60 240 0.008
(iii) 120 180 0.016
(iv) 240 60 0.032
(v) 300 0 0.04
(h) Preparation of sample-
(A) For liquid and viscous (gel) product.-
(i) dilute the test sample appropriately with water such that the absorbance of the sample is
within the range of the standard curve;
(ii) in case of coloured samples, add activated charcoal (1% v/v) to the aqueous solution of the
sample and stir well for ten minutes using vortex mixer followed by the filtration; and
(iii) use the filtrate for the estimation of -Carrageenan.
(B) For granular/flakes product.-
(i) take 10 gram of test sample granule or flake in a conical flask containing 90 ml of water;
(ii) incubate at room temperature for forty five minutes and mix the components to homogeneity
on a magnetic stirrer;
(iii) withdraw 2 ml of sample and centrifuge at 3000 rpm for three minuets; and
(iv) the supernatant thus obtained shall be used for analysis of carrageenan or sulphated sugar.
Note: To estimate the concentration of carrageenan or sulphated sugar in the sample containing
approximately 25 mg/ml sulphated sugar, the sample needs to be diluted by 103 fold, so that the
approximate concentration of diluted sample is 0.025 mg/ml, which is within the limit of standard
curve.
8.3 Procedure.-
(i) take 60 μl of standard (or sample) solution as prepared above and add 240 μl of TBO solution
(Reagent A);
(ii) mix the solution to homogeneity;
(iii) measure absorbance at 630 nm;
(iv) prepare standard curve using concentration in X axis and absorbance in Y axis; and
(v) calculate the concentration of carrageenan in test sample from standard curve.
8.4 Calculation.-
Calculate the total carrageenan content of the test sample using the formula as below.-
Concentration of carrageenan x dilution factor
% Carrageenan = X 100
Weight of sample taken[भाग II—खण्ड 3(ii)] भारत का रािपत्र : असाधारण 65
8.5 Reference.-
Ziolkowska D, Kaniewsk A, Lamkiewicz J, Shyichuk A. 2017, Determination of carrageenan by
means of photometric titration with methylene blue and Toluidine blue dyes. Carbohydrate
Polymers 165: 1-6
9. Detection and quantification of fucoidan.-
9.1 Equipment.-
(a) HPLC-RID system.
(b) analytical balance.
(c) 0.45 µ syringe filter.
(d) vortex mixer.
9.2 Chemicals and Reagent Preparation.-
(a) fucoidan (CAS No. 9072-19-9).
(b) ultra pure water
(c) standard Preparation:
(i) prepare a series of fucoidan standards in ultra pure water (5 ppm to 500 mg/ml);
(ii) Fucoidan stock standard solution: weigh about 10 mg of fucoidan in 10 ml volumetric
flask and dilute it with 10 ml ultrapure water and it gives a stock solution of 1000 mg/ml;
(iii) Fucoidan intermediate standard solution: dilute 1.0 ml stock standard to 10 ml with
ultrapure water and mix well and it gives an intermediate standard solution of 100 mg/ml;
(iv) dilute 1.0 ml of intermediate standard solution to 10 ml with ultrapure water and it gives
an intermediate standard solution of 10 mg/ml; and
(v) prepare linearity point as specified under sub paragraph (c) (v) of paragraph 7.2 in the
Part-D of schedule-VI.
(d) sample preparation: same as specified under sub paragraph (d) of paragraph 7.2 in the Part-D
of schedule-VI
9.3 Procedure and Calculations.-
Same as specified in under paragraph 7.3 and 7.4 in the Part-D of schedule-VI.
(Note:Since sodium alginate interfere with fucoidan, prior to the preparation of the sample, add 2%
CaCl solution to precipitate out alginates and use the remaining solution for fucoidan estimation).
2
10. Estimation of mannitol.-
10.1 Equipment.-
(a) HPLC- RID system.
(b) detector: Refractive index detector.
(c) online vacuum degasser.
(d) quaternary pump
(e) high speed centrifuge.
(f) analytical balance.
(g) vortex mixer.
(h) sonicator.
(i) 0.45µ syringe filters.
10.2 Chemicals and Reagent Preparation.-
(a) D-Mannitol (CAS No.69-65-8).
(b) ultra pure water.
(c) acetic acid (0.05%) : Take 0.5 ml of acetic acid in 1liter of HPLC water in mobile phase container.
(d) standard preparation:
(i) prepare a series of mannitol standards in ultrapure water (5 ppm to 500 mg/ml);66 THE GAZETTE OF INDIA : EXTRAORDINARY [PART II—SEC. 3(ii)]
(ii) Mannitol stock standard solution that is weigh about 10 mg of mannitol in 10 ml
volumetric flask and dilute it with 10 ml ultrapure water and it gives a stock solution of
1000 mg/ml;
(iii) for Mannitol intermediate standard solution that is dilute 1.0 ml stock standard to 10 ml
with ultrapure water and mix well and it will give an intermediate standard solution of
100 mg/ml;
(iv) dilute 1.0 ml of intermediate standard solution to 10 ml with ultrapure water and it gives
an intermediate standard solution of 10 mg/ml; and
(v) prepare linearity point as specified under sub paragraph (c) (v) of paragraph 7.2 in the
Part-D of schedule-VI.
(e) Sample preparation: same as specified under sub paragraph (d) of paragraph 7.2 in the Part-D
of schedule-VI.
10.3 Procedure and Calculations.-
(a) Same as specified under sub paragraph 7.3 and 7.4 of the Part-D of schedule-VI.
10.4 Reference.-
Valverde S, Hernández-Apaolaza L, Lucena J.J. 2022. A Simple Analytical Method to Determine Alginic
Acid, Laminarin and Mannitol and Seaweed Extracts Fertilisers. Journal of Chromatography and
Separation Techniques, Volume-13, Issue 1 No: 1000470.
11. Estimation of total poly-phenols.-
11.1 Equipment-
(a) spectrophotometer.
(b) analytical balance.
(c) high speed centrifuge.
(d) vortex mixer.
(e) water bath.
11.2 Chemicals and Reagent Preparation.-
(a) gallic acid(CAS No 149-91-7) or phloroglucinol (CAS No 108-73-6)
(b) Folin- Ciocalteu Reagent (CAS No 12111-13-6).
(c) 80% aqueous methanol that is to 80 ml of methanol add 20 ml of water.
(d) 20% sodium carbonate that is to weigh 20 g of sodium carbonate and transfer it to 100 ml volumetric
flask. Add 40 ml of water and shake vigorously to dissolve and make up the volume to 100 ml with
water.
(e) Sample preparation
(i) Liquid and gel samples
The algal or liquid biostimulant samples are to be extracted with eighty percent methanol.
(1) extract 1ml of the seaweed biostimulant sample with 10 ml of eighty percent aqueous
methanol (extraction ratio- 1:10 v/v) overnight at 4°C in dark;
(2) vortex the mixture thoroughly and centrifuge at 12000 ×g for five minutes at 4°C; and
(3) collect the supernatant and use it for further analysis.
(ii) solid samples (powder, granules and flakes).-
(1) extract accurately weighed homogenized algal tissue or solid test sample (0.3 ± 0.005
gram) with 15 ml of 80% aqueous methanol overnight at 4°C in dark;
(2) vortex the mixture thoroughly and centrifuge at 12000 × g for five minutes at 4°C;
and
(3) collect the supernatant and use it for further analysis.
(f) Gallic acid standard preparation.-
(i) accurately weigh about 100 mg gallic acid, and transfer into a 100 ml volumetric flask and add
about 75 ml water and mix well until the solids are dissolved;
(ii) make up the volume to 1000 ml with water and mix well;[भाग II—खण्ड 3(ii)] भारत का रािपत्र : असाधारण 67
(iii) label it as “stock standard solution.” This stock standard solution (ca 1000 mg/L gallic acid)
may be used for up to 1 month when stored at 2–8°C; and
(iv) prepare calibration standard solutions as shown in Table (ca 40–200 mg/l gallic acid) by
pipetting the indicated amount of stock standard solution into the indicated size volume flask
and diluting to volume with water and the following approximate concentrations of gallic acid
in each of the calibration standard solutions are specified in table below.-
Table
S. No. Calibration volume stock Volume of approximate
standard flask, ml concentration of gallic
Standard solution
solution, ml acid, mg/L
(i) 1 1 25 40
(ii) 2 2 25 80
(iii) 3 3 25 120
(iv) 4 4 25 160
(v) 5 5 25 200
11.3 Procedure.-
(1) add an aliquot of 1 ml of supernatant to 15 ml of distilled water and 1 ml of Folin- Ciocalteu reagent
in a test tube;
(2) to mix the contents of the tube thoroughly and incubate for five minutes;
(3) after five minutes of incubation, add 3 ml of 20% sodium carbonate followed by heating the test
tubes at 50°C for thirty minutes in a water bath;
(4) measure the absorbance using a spectrophotometer at 765 nm after removal from water bath;
(5) to prepare a standard curve (40-200 mg/liter) with above method using Gallic acid or
phloroglucinol as reference; and
(6) express the concentration of phenolic compounds in gallic acid or phloroglucinol equivalents.
11.4 Calculations.-
Calculate the total phenolics as mg gallic acid equivalent (GAE) / gram sample
GAE (mg/g) = C x V/ M
Where: C = concentration of gallic acid obtained from calibration curve in mg/ml
V = Volume of extract in ml
M= Mass of extract in gram
11.5 Reference-
Kupina S, Fields C, Roman MC 2019. Determination of total phenolic content using Folin-C-Assay:
Single Laboratory validation, First Action 2017.13. Journal of AOAC International. 101: pp 1466-
1472.
12. Estimation of Humic acid and fulvic acid-.
12.1 Equipment.-
(a) analytical balance.
(b) drying oven.
(c) high speed centrifuge.
(d) rotary evaporator.
(e) pH meter.
(f) spectrophotometer.
(g) peristaltic pump.68 THE GAZETTE OF INDIA : EXTRAORDINARY [PART II—SEC. 3(ii)]
(h) muffle furnace.
(i) rotating shaking mixer.
(j) desiccator
12.2 Chemicals and Reagent preparation-
(a) sodium hydroxide.
(b) hydrochloric acid.
(c) nitrogen gas- 99.96% purity.
(d) Supelco Superlite DAX-8 resin.
(e) Amberlite IR 20 strong cation exchange resin.
12.3 Procedure-
(a) Alkaline extraction-
(i) If the material is solid or granular, prepare analytical samples by crushing them to fine powder
using a pestle and mortar so that crushed sample passes through Sieve mesh size of 60–80;
(ii) To determine the moisture content gravimetrically as follows-
(a) weigh an aluminum weigh boat and record mass (Wt1);
(b) transfer 2 ± 0.5 gram test portion of the analytical sample into the weigh boat, weigh,
and record mass (W1);
(c) place the sample in drying oven for 24 ± 0.2 h at 90°C; after twenty four hours, remove
from drying oven and place in desiccator to cool for one hour; weigh and record mass
of weigh boat and dry test portion (W2);
(d) determine the moisture ratio using Equation
Moisture ratio = [(W1 – W2)/(W1 – Wt1)]
(iii) weigh about 2- 5 gram of second test portion from the analytical sample (W3: exact weight of
sample used) and place it into a precalibrated or premarked one liter Erlenmeyer flask;
(Note: The amount of test sample taken shall contain approximately 2.5 gram humic acid).
(iv) add 0.1 M Sodium Hydroxide (that is, 4 gram Sodium Hydroxide per l liter distilled water) with
stirring, and make to a final volume of 1 liter and determine the dry weight of the test portion
using Equation:
Dry test portion dry weight = (W3) (1 – moisture ratio)
(v) for liquid materials, thoroughly mix the analytical sample by stirring with a glass rod for one
minute, ensuring that any residue that may have fallen to the bottom of the container is thoroughly
mixed;
(vi) add an aliquot of a test portion of the analytical sample, noting the volume (V1), into a
precalibrated or premarked 1 liter Erlenmeyer flask, and bring to a final volume of 1 liter with 0.1
M Sodium Hydroxide;
Note: The test portion shall result in a concentration of 200 to 600 mg/liter humic acid and fulvic
acid after dilution with 0.1 M Sodium Hydroxide, the aliquot volume will be based on the humic
acid and fulvic acid product concentrations that are claimed in test sample.
(vii) determine the density (gram/ml) of the liquid material by weighing 10 ml of well-mixed analytical
sample in a pretared graduated cylinder (D1) and determine the weight of the liquid test portion
using equation:
Liquid test portion weight (gram) = (V1) (D1)
(viii) add a 0.8 to 1.2 centimeter long magnetic stir bar, replace the air in the headspace with Nitrogen,
and cover with parafilm, mix vigorously on a stir plate (e.g., 200–300 rpm); stir solid materials
for six hours to extract humic substances and the liquid materials for one hour to ensure
dissolution of all humic acid and fulvic acid;[भाग II—खण्ड 3(ii)] भारत का रािपत्र : असाधारण 69
(ix) from this point on, the method is the same for both solid and liquid materials;
(x) after stirring, remove the flask from the stir plate, transfer the contents to centrifuge tubes, and
centrifuge the entire volume to separate any insoluble material from the dissolved humic acid and
fulvic acid;
(xi) centrifuge at 3900 × g for ten minutes (use 50 ml centrifuge tubes, or larger, as available), discard
the insoluble precipitates and collect the alkaline supernatant containing the humic acid and fulvic
acid in a clean one liter Erlenmeyer flask;
(xii) while the extract solution is being mixed with a stir bar, carefully insert a pH electrode into the
middle portion of the solution and to flocculate the humic acid, add concentrated hydrochloric
acid (1:1) dropwise to the alkaline extract until pH is reached to 1.0 ± 0.05;
(xiii) cover the flask with parafilm and mix for one hour, check pH and readjust to pH 1.0 with
additional concentrated hydrochloric acid (1:1) if necessary and if the pH falls below 0.95, adjust
pH back to 1.0 ± 0.05 with the 0.1 M sodium hydroxide solution and continue to let the acidified
extract mix and check pH occasionally until it is stable at pH = 1 ± 0.05 for five minutes; and
(xiv) once the pH is stable, remove the flask from mixer and cover with Parafilm and let the mixture
sit unstirred until precipitated humic acid is fallen to the bottom of the flask.
Note: The time for humic acid to precipitate from solution varies greatly among products, but a
typical time range is 1 to 6 h.
(b) Separation of Humic acid.-
(i) once the humic acid is completely precipitated, decant the fulvic acid containing extract (fulvic
fraction) into a clean one liter Erlenmeyer flask, being careful not to include any of the humic acid
precipitate and with some products, the precipitated humic acid will remain in suspension as
colloidal particles, if so centrifuge the entire volume to separate the flocculated humic acid from
the acidified fulvic fraction;
(ii) pour the remaining mixture into centrifuge tubes and centrifuge at 3900 × g for 0.5 hours to
separate the humic acid precipitate; and
Note: If necessary, a higher g force or longer centrifugation time may be used to obtain a clean
separation of the fulvic extract supernatant from the humic acid precipitate.
(iii) add the supernatant to the fulvic acid containing acidified extract.
(c) Determination of Humic acid concentration.-
(i) place the centrifuge tubes containing the precipitated humic acid in a drying oven set at 90°C, and
dry the humic acid to constant weight (typically twenty four hours), constant weight is achieved
when the tube and humic acid (or fulvic acid) weigh the same after an additional two hours drying
time; and
(ii) after drying, remove the tubes from the drying oven and place in a desiccator to cool to room
temperature and after cooling, quantitatively transfer the residue from the tube by scraping it from
the sides and bottom of the tube with a spatula, transfer to a tared weigh boat, and record the mass
(W4HA) and this residue is the “Extracted humic acid”.
(d) Determination of Ash Content.-
(i) transfer the extracted humic acid to a pre-weighed (Wt2) ceramic dish that had been previously
dried in a drying oven set at 90°C and then cooled in a desiccator to room temperature;
(ii) record the combined mass of the extracted humic acid and dish (W5) and transfer the dish to a
muffle oven for four hours at 500°C for combustion;
(iii) while still warm, remove the dish and contents from the muffle oven and place in a desiccator to
cool and once cool, weigh the dish with ash (W6) and calculate the ash ratio by the following
equation-
Ash ratio = [(W5 – W6)/(W5 – Wt2)]; and
(iv) determine the final mass of the extracted humic acid by correcting for ash content using following
equation-
weight of extracted humic acid without ash (gram) = (W4HA)(1 – Ash Ratio).70 THE GAZETTE OF INDIA : EXTRAORDINARY [PART II—SEC. 3(ii)]
(e) Separation of Fulvic Acid.-
(i) to separate fulvic acid from the other acid-soluble compounds in the fulvic fraction by using a 40
× 250 mm glass column prepared with a nonionic macroporous acrylic ester resin (that is, Supelite
DAX-8);
Note: Through selective adsorption, hydrophilic acid-soluble components do not bind to the resin
and are removed.
(ii) pass the fulvic fraction through the column using a peristaltic pump, under low pressure, via the
top of the column and it is critical that the top of the resin in the column remains covered with
solution until all the extract has been added to prevent drying of the resin;
(iii) once the fulvic fraction has been completely loaded onto the resin, wash the resin with deionized
water by pumping it through the top of the column using the peristaltic pump under low pressure
and discard the effluent;
(iv) wash the column until the absorbance at 350 nm of the column effluent is equal (e.g., within 0.015
absorbance units) to that of the deionized water used to wash the column, a wavelength of 350
nm gives strong absorbance by fulvic acid and allows the use of a spectrophotometer that only
measures visual wavelengths;
(v) desorb the fulvic acid by back elution (that is, influent introduced into the bottom of column) by
pumping 0.1 M Sodium hydroxide using the peristaltic pump, most of the fulvic acid is adsorbed
to the very top of the DAX-8 resin and desorption from the column bottom uses a minimal amount
of 0.1 M Sodium hydroxide to fully desorb the fulvic acid;
(vi) all the fulvic acid has been desorbed when the absorbance of the column effluent is equal to the
absorbance of influent at 350 nm, use 0.1M Sodium hydroxide as the spectrophotometric blank
and add the effluent taken to check absorbance of the desorbed fulvic acid solution;
(vii) protonate and de-ash the fulvic acid by passing repeatedly (by gravity feed) through Amberlite
IR120 hydrogen form ion exchange resin contained in a 5 × 50 cm column until the electrical
conductivity of the effluent is <120 uS/m as measured with a conductivity meter;
(viii) to ensure that all the fulvic acid is removed from the resin after the final pass, wash the column
with deionized water until the absorbance of effluent at 350 nm is the same (e.g., within 0.015
absorbance units) as the deionized water used to wash the column, use deionized water as the
spectrophotometric blank and add the wash and any effluent portions taken to check absorbance
to the purified fulvic acid solution;
(ix) to help with removal of all fulvic acid, the resin to be agitated (e.g., using a long glass or plastic
rod) several times;
(x) concentrate the fulvic acid to a volume of approximately 15 ± 2 ml by using a rotary evaporator
at 55°C;
(xi) completely transfer the 15 ml fulvic acid concentrate to a 50 ml plastic centrifuge tube and dry at
90°C to constant dryness in a drying oven (freeze drying is an alternative to oven drying); and
(xii) after drying, as described for the humic acid, place the tube in a desiccator to cool and remove
fulvic acid from the tube by complete scraping of the tube sides and bottom with a spatula, and
weigh it on pretared weigh paper (W8) and this material is the “Extracted Fulvic acid”;
(xiii) determine the residual ash content of extracted fulvic acid as described for humic acid and
calculate the ash ratio; and
(xiv) finally, determine the weight of the extracted Fulvic acid without ash using following equation:
Weight of extracted fulvic acid without ash (gram) = (W4FA) (1-Ash Ratio).
(f) Column Regeneration.-
(i) regenerate the DAX-8 resin by pumping 0.1M hydrochloric acid [8.33 ml concentrated
hydrochloric acid per 1000 ml final volume deionized (DI) water] through the bottom of the
column until the pH of the effluent is equal to the pH of the influent, use the peristaltic pump to
pump all reagents through the DAX-8 column during regeneration;
(ii) next, rinse the column with deionized water by pumping it into the top of the column until the
pH of the effluent equals the pH of the influent (that is of deionized water);
(iii) regenerate the H+ form cation exchange resin in a batch process by pouring the resin into a large
beaker (e.g., 4 L plastic beaker), pour off the water, and cover the resin with 1M hydrochloric
acid [83.3 ml concentrated HCl per 1000 ml final volume deionized (DI) water];[भाग II—खण्ड 3(ii)] भारत का रािपत्र : असाधारण 71
(iv) let stand for a minimum of thirty minutes with occasional stirring(e.g., once every five minutes
and remove the excess acid from the resin by pouring off the acid and covering the resin with
deionized water;
(v) stir vigorously with a stirring rod for fifteen seconds, then let the resin and rinse water sit for
five minutes, repeat the process until the pH of the rinse water equals the pH of the deionized
water; and
(vi) load the regenerated resin back into the column, once loaded, rinse the resin with deionized
water and check the pH of the effluent and if it is still lower than the pH of the deionized water
before it is passed through the column, continue to rinse the column with deionized water until
the pH of the effluent is within 0.1 pH units of the pH of the influent.
12.4 Reference.-
Lamar RT, Olk DC, Mayhew L and Bloom PR 2014, A New Standardized Method for Quantification
of Humic and Fulvic Acids in Humic Ores and Commercial Products. Journal of AOAC International,
97 (3): 721- 730.
13. ESTIMATION OF TOTAL CONTENT OF FREE AMINO ACIDS.-
13.1 Equipment.-
(a) water bath or dry block thermostat.
(b) spectrophotometer.
(c) centifuge.
(d) analytical balance.
13.2 Chemicals and Reagent Preparation.-
(a) ninhydrin (CAS No 485-47-2).
(b) hydrindantin (CAS No 5103-42-4).
(c) glycine (CAS No 56-40-6).
(d) acetic acid (CAS number: 64-19-7).
(e) potassium acetate (CAS number: 127-08-2).
(f) dimethyl sulfoxide (CAS number: 67-68-5).
(g) 2-Propanol (CAS number: 67-63-0).
(h) distilled water.
(i) 2-Propanol/water = 1/1 (v/v) (mix 500 ml 2-propanol with 500 ml water).
(j) acetate buffer- Dissolve 98.1 gram of potassium acetate and 111 ml of glacial acetic acid in water
to a final volume of 500 ml.
(k) ninhydrin reagent- Dissolve 550 mg ninhydrin and 22 mg hydrindantin in 11 ml DMSO and mix
the solution with 11 ml of acetate buffer, use the reagent directly after preparation.
(l) glycine Standard solution (10000 mg/ml)- weigh 100 mg of glycine standard and place it in 10 ml
volumetric flask, dissolve it in small quantity of distilled water and make up the volume to 10 ml
with distilled water.
(m) sample solution- take 1gram of sample to be analysed in 100 ml of volumetric flask, dissolve it in
small quantity of distilled water, make up the volume to 100 ml with distilled water, mix the
contents thoroughly by shaking for half an hour and dilute the sample, if required and use the
dilution factor (DF) in the calculation.
13.3 Procedure.-
(i) pipette out different volumes (10 µl, 20 µl, and so on) of the glycine standard solution (10000
ppm) into a series of test tubes and make up the volume to 1 ml with distilled water and it gives
working standard concentration of 10, 20, 30, 40, 50, 60, 70, 80, 90 and 100 mg/ml);72 THE GAZETTE OF INDIA : EXTRAORDINARY [PART II—SEC. 3(ii)]
(ii) take 200 µl of sample or standard in 1.5 ml reaction tubes and add 800 µl of Ninhydrin reagent to
it;
(iii) centrifuge the tubes for ten seconds to ensure that no drops of mixture remain in the caps of the
tubes;
(iv) cover the tubes with caps on top and incubate the tubes in dry block thermostat or in a water bath
at 90oC for forty five minutes;
(v) cool the tubes to room temperature and transfer exactly 500 µl to a 3 ml cuvette and add 2.5 ml
of mixture of 2-propanol/water in 1:1 ratio (v/v) to it and mix the contents well;
(vi) measure the optical density of the solutions at 570 nm against a blank;
(vii) prepare a standard curve of absorbance against amino acid concentration; and
(viii) determine the amount of amino acid in the unknown sample by plotting a standard curve of A570
on the Y-axis and concentration of amino acid on the X-axis.
(ix)
13.4 Calculations.-
Calculate the total amount of free amino acids using following formula
Concentration by graph (mg/L) x Make up volume x DF (if any)
Concentration (mg/kg) =
Weight of sample (g)
Concentration (mg/kg)
For result in % =
10000
13.5 Reference.-
Stauß, A.C., Fuchs, C., Jansen, P., Repert, S., Alcock, K., Ludewig, S., Rozhon, W. 2024. The ninhydrin
reaction revisited : optimization and application for quantification of free amino acids, Molecules, 29,
3262.
14. Estimation of free amino acid analysis (for specific amino acid).-
Amino acid analysis using HPLC with a fluorescence detector and AccQ•Tag Ultra-2A reagent involves a
method where amino acids from a sample are first chemically derivatized (labeled) with the AccQ•Tag Ultra-
2A reagent and derivatization allows for highly sensitive detection of each amino acid by fluorescence when
separated on an HPLC column, enabling accurate quantification of the individual amino acids present in the
sample.
14.1 Equipment.-
(a) UHPLC system with FLD (Fluorescence detector), alternative equipment may be used for this
method but will require adapting the separation gradient to ensure separation of all compounds.
(b) chromatography column: C18, 3.9 mm × 150 mm x 4µ (particle size).
(c) adjustable micropipets (10, 20, 200, and 1000μl) and tips.
(d) vortex mixer.
(e) analytical balance.
(f) heating block.
(g) laboratory oven.
14.2 Chemicals and Reagent preparation.-
(a) AccQ•Tag Ultra Derivatization kit- to prepare the reagents included in the kit following the
manufacturer’s instructions:
(1) AccQ•Tag Ultra Borate buffer (reagent 1), ready-to-use solution, alternative reagent: 5% (w/v)
sodium tetraborate in water; and
(2) AccQ•Tag Ultra reagent (vials 2A and 2B), reconstitute AccQ•Tag Ultra reagent (vial 2A)
according to following the kit manufacturer’s instructions:[भाग II—खण्ड 3(ii)] भारत का रािपत्र : असाधारण 73
(i) preheat a heating block to 55°C;
(ii) tap vial 2A lightly before opening to ensure all AccQ•Tag Ultra reagent powder is at the
bottom of the vial;
(iii) rinse a clean micropipette by drawing and discarding 1 ml AccQ•Tag Ultra reagent
diluent from vial 2B (ready-to-use solution), repeat two times;
(iv) draw 1.0 ml from vial 2B, transfer it to the AccQ•Tag Ultra reagent powder in vial 2A
and cap the vial tightly, mix on a vortex mixer for approximately ten seconds, then heat
vial 2A on top of the preheated heating block at 55°C until the AccQ•Tag Ultra reagent
powder is dissolved; and
Note: Do not heat the reagent for longer than ten minutes.
(v) once reconstituted, the AccQ•Tag Ultra reagent is approximately 10 mM. Store
reconstituted AccQ•Tag Ultra reagent in a desiccator at room temperature for up to one
week.
Note: AccQ•Tag Ultra reagent reacts with atmospheric moisture, seal the container
tightly when not in use and do not refrigerate.
(b) amino acid standard solution.- Containing the following seventeen amino acids at 2.5 μmol/ml (or 2.5
mM) each (except L-cystine at 1.25 μmol/ml) L-alanine, L-arginine, L-aspartic acid, Lcystine, L-
glutamic acid, L-glycine, L-histidine, L-isoleucine, L-leucine, L-lysine, L-methionine, L-
phenylalanine, L-proline, L serine, L-threonine, L-tyrosine, and L-valine. Store 2.5 mM calibration
standard stock solution at –20°C for up to six months as 250 μL aliquots.
(i) 0.5 mM amino acid solution.- Add 600 μL 0.1M hydrochloric acid to 150 μL 2.5
mM amino acid solution.
(ii) 0.05 mM amino acid solution.—Add 900 μL 0.1 M hydrochloric acid to 100 μL 0.5
mM amino acid solution.
Note: Both 0.5 mM and 0.05 mM amino acid solutions are to be freshly prepared for each
analysis.
(c) chromatography solvents (mobile phases)-
(i) Eluent A (Solvent A), to prepare Eluent A from AccQ•Tag Ultra Eluent A (ammonium
formate eighty four per cent, formic acid six per cent, acetonitrile ten per cent, by volume)
concentrate as follows:
(1) Measure 850 ml water into a 1 L graduated cylinder;
(2) In a separate graduated cylinder, measure 150 ml AccQ•Tag Ultra Eluent A
concentrate; and
(3) add the concentrate to the water and mix thoroughly.
Note: Eluent A concentrate, once opened, must be stored tightly capped at around 4°C. Dilute
Eluent A is stable for 1 week at room temperature.
(ii) Eluent B (Solvent B), to prepare AccQ•Tag Eluent B (acetonitrile with addition two per cent
of formic acid, by volume) is supplied as a working solution; no additional preparation is
required
Note: Eluent B, once opened, must be stored tightly capped at around 4°C for no longer than one
month, for Alternative Eluent B, use HPLC grade acetonitrile supplemented with two percent (w/w)
formic acid.
(d) wash solvents-
(i) The weak needle wash solvent is five percent (v/v) acetonitrile in water;
(ii) The strong needle wash solvent is ninety five percent (v/v) acetonitrile in water; and
(iii) The seal wash solvent is fifty per cent (v/v) acetonitrile in water.74 THE GAZETTE OF INDIA : EXTRAORDINARY [PART II—SEC. 3(ii)]
(e) sample preparation and neutralization.-
(i) weigh about 1 gram (±10 %) of sample in 10 ml volumetric flask and make up the volume to 10 ml,
sonicate for ten minutes;
(ii) transfer 0.2 ml of sample into a 1.5 ml microcentrifuge tube and add 0.2 ml 6M sodium hydroxide
solution and then 0.4 ml 0.1M hydrochloric acid, mix well and filter through a 0.45µ membrane filter
into another 1.5ml tube.
(f) Derivatisation (of samples and amino acids standards).-
Derivatisation converts free amino acids into highly stable derivatives, standards and samples are
derivatized following process as described below:
(i) preheat a heating block to 55°C;
(ii) with a micropipette, add 70 μl AccQ•Tag Ultra Borate buffer to a clean 12 × 32 mm
glass screw neck total recovery vial;
(iii) add 10 μl calibration standard, neutralized sample solution to the vial;
(iv) mix briefly on a vortex mixer;
(v) add 20 μl reconstituted AccQ•Tag Ultra reagent to the sample vial;
(vi) mix the solution immediately by pipetting up and down several times;
(vii) cap and mix on a vortex mixer immediately for several seconds, and tap the vial to ensure
that no bubble is trapped;
(viii) let stand for one minute at room temperature; and
(ix) heat the vial in a heating block for ten minutes at 55 ± 1°C.
(g) Ultra-High-Performance Liquid Chromatography (UHPLC) separation.-
(i) prime solvent lines for five minutes;
(ii) prime wash sample syringes for four cycles;
(iii) allow the chromatographic system to stabilize before injecting standards and samples, make
sure the system pressure and initial conditions are stable before performing injections
(around 9000 psi);
(iv) before starting a series of analyses, inject two blanks (water) to condition the column;
(v) inject 1μl each derivatised calibration standard and then inject 1μl derivatised sample
solutions;
(vi) perform single injections and add a blank injection (water) at the end of each calibration
series; and
(vii) perform the Ultra-High-Performance Liquid Chromatography (UHPLC) under the
conditions specified in the Table below and operating conditions may vary depending on the
apparatus (follow the instruction manual):[भाग II—खण्ड 3(ii)] भारत का रािपत्र : असाधारण 75
Table (Chromatographic Conditions)
(i) Instrument HPLC
(ii) Detector FLD (Fluorescence detector)
(iii) Column Waters Nova-Pak C18, 150 mm x 3.9 mm, 4 µ
(particle size)
(iv) Column temperature 30oC
(v) Flow rate 1 ml/minute
(vi) Pump mode Gradient
(vii) Run time 60 minutes
(viii) Wavelength Excitation- 250 nm and Emission- 395 nm
(ix) Injection volume 5 µl
Table (Gradient program)
S. No. Time Per cent A Per cent B
(i) 0.00 99 1
(ii) 0.50 98 2
(iii) 14 93 7
(iv) 18 90 10
(v) 21 90 10
(vi) 33 78 22
(vii) 39 77 23
(viii) 42 67 33
(ix) 49 67 33
(x) 50 30 70
(xi) 52 30 70
(xii) 53 99 1
(xiii) 60 99 1
(h) Peak identification and integration.-
(i) identify the amino acid peaks in the sample solution by comparison with the retention times of
the corresponding peaks obtained in the calibration standards; and
(ii) check that peaks are separated with a good resolution (baseline separation) and if this is not the
case, adapt the chromatographic conditions (e.g., gradient, temperature, tubing length, etc.)
accordingly.
14.3 Calculation.-
Integrate the peak responses observed in the HPLC for sample as well as standard and calculate each
Amino acid by using the formula:
Sample Area x Standard concentration
Amino acid in mg/gram=
Standard Area x Sample weight
Amino acid in mg/g x 100
Amino acid % (w/w) =
100076 THE GAZETTE OF INDIA : EXTRAORDINARY [PART II—SEC. 3(ii)]
14.4 Reference.-
Jaudzems G and J Guthrie J 2019. Total Amino Acids by UHPLC–UV in Infant Formulas and Adult
Nutritionals, First Action 2018.06. Journal of AOAC International 102: 1574- 1588.
15. Estimation of total amino acids (from total nitrogen).-
(1) protocol detailed as in paragraph 3 in Part B of Schedule II to be followed for estimation of total
nitrogen (in nitrate free samples);
(2) the total nitrogen estimated as per the above protocol, should be used for estimation of total amino
acids in the formulation using the formula;
Crude protein (%) = Total nitrogen (estimated by Kjeldahl method) x 6.25
Note: All the amino acids contains 16 % of nitrogen; hence the multiplying factor derived and used
as 6.25 (100/16).
(3) in the protein hydrolysate sample, 70% of the nitrogen content is from amino acids and after
calculating crude protein, calculate the amino acid content as follows.-
Amino acids (%) = Crude protein x (70/100 )
16. Estimation of myo- inositol. -
16.1 Equipment.-
(a) HPLC with Column: Amino (250 mm x 4.6mm); 5µ (Particle size).
(b) evaporative light scattering detector (ELSD).
(c) analytical balance.
(d) 0.22µ syringe filter.
16.2 Chemicals and Reagent Preparation.-
(a) myo Inositol (CAS No. 87-89-8).
(b) acetonitrile(CAS No. 75-05-8).
(c) ultrapure water.
(d) myo Inositol standard stock preparation: weigh about 50 mg of Inositol standard in 10 ml
volumetric flask and dilute it with 10 ml water and it gives a stock solution of 5000 ppm.
(e) myo- Inositol intermediate standard solution: Dilute 2.0 ml stock standard to 10 ml with water
and mix well. It gives an intermediate standard solution of 1000 ppm.
(f) prepare following linearity point as per sample concentration specified in the table below-
Table
S. No. Linearity Concentration Volume Volume Concentration of
standard of stock solution (ml) of (ml) of standard
(ppm) stock water to be (mg/ml)
solution to used
be used
(i) Standard 1 1000 ppm 0.10 0.90 100
(ii) Standard 2 1000 ppm 0.25 0.75 250
(iii) Standard 3 5000 ppm 0.10 0.90 500
(iv) Standard 4 5000 ppm 0.16 0.84 800
(v) Standard 5 5000 ppm 0.20 0.80 1000
(g) Sample preparation.-
(i) thoroughly mix or stir products prior to sampling;
(ii) for liquid products, accurately weigh 0.5 to 5 g (±10%) of product into a 50 ml volumetric
flask and record the weight to the nearest 0.0001 gram;
(iii) for powdered samples, which that do not require reconstitution, accurately weigh 0.25 to 2.0
g powder into a 50 ml volumetric flask and record the weight to the nearest 0.0001 gram;[भाग II—खण्ड 3(ii)] भारत का रािपत्र : असाधारण 77
(iv) add approximately 10 to 15 ml water to the volumetric flask and swirl or stir to completely
dissolve the powder and for powdered products that are not homogeneous at the sub-gram
level, reconstitute following the product label instructions and accurately weigh 0.5 to 5 g
reconstituted product into a 50 ml volumetric flask and record the weight to the nearest
0.0001 gram;
(v) make up the volume to 50 ml with water; and
(vi) sonicate it for thirty minutes and filter it through 0.22µ syringe filter.
16.3 Procedure.-
(i) HPLC analysis.- following as specified in table below for instrument operating conditions
and ELSD settings.-
Table (HPLC Conditions)
(i) Column Amino (250 mm x 4.6mm); 5 µ
(Particle size)
(ii) Detector Evaporative light scattering Detector
(ELSD)
(iii) Detector temperature 50oC
(iv) ELSD gain 6
(v) ELSD Chamber temperature 40oC
(vi) Pressure of nitrogen in nebulizer 2.9 bar
(vii) Flow rate 2 ml/ min.
(viii) Column temperature 25oC
(ix) Mobile phase A- Acetonitrile (80%)
B- Water (20%)
(x) Run time 20 minutes
(xi) Injection volume 5 µl
16.4 Calculation.-
sample area x standard concentration x dilution
Myo Inositol (mg/kg)=
standard area x Sample weight
16.5 Reference.-
Pazourek J. 2014. Fast separation and determination of free myo-inositol by hydrophilic liquid
chromatography. Carbohydrate Research, 391: 55-60.
17. Estimation of Vitamin C (ascorbic acid)-
17.1 Equipment-
(a) HPLC with Column: C18 (250 mm x 4.6mm); 5 µ (Particle size).
(b) UV detector.
(c) analytical balance.
(d) 0.22 µ syringe filter.
17.2 Chemicals and Reagent Preparation-
(a) ascorbic acid.78 THE GAZETTE OF INDIA : EXTRAORDINARY [PART II—SEC. 3(ii)]
(b) 20mM Monobasic phosphate buffer: Dissolve 2.76g of sodium dihydrogen phosphate (NaH PO )
2 4
in approximately 800ml of distilled water in a one liter volumetric flask, adjust the pH to 8.5 using
orthophosphoric acid, and finally dilute to the one liter mark with distilled water.
(c) ortho phosphoric acid.
(d) methanol.
(e) acetonitrile.
(f) methanol: acetonitrile (60: 40).
(g) ultrapure water.
(h) ascorbic acid stock standard solution: Weigh about 10 mg of Ascorbic acid standard in 10 ml
volumetric flask and dilute it with 10 ml mobile phase, it gives a stock solution of 1000 mg/ml.
(i) ascorbic acid intermediate standard solution: Dilute 1.0 ml stock standard to 10 ml with mobile
phase and mix well, it gives an intermediate standard solution of 100 ppm and from this standard
solution, dilute 1.0 ml of intermediate standard solution to 10 ml with mobile phase and it gives
an intermediate standard solution of 10 ppm.
(j) prepare linearity point as per sample concentration specified in the table below.
Table
S. No. Linearity Conc. of Volume (ml) Volume Concentration
standard. stock of stock (ml) of of standard
solution solution to be water to be (mg/ml).
(ppm). used. used.
(i) Standard 1 10 ppm 0.10 0.90 1
(ii) Standard 2 10 ppm 0.20 0.80 2
(iii) Standard 3 100 ppm 0.05 0.95 5
(iv) Standard 4 1000 ppm 0.10 0.90 10
(v) Standard 5 1000 ppm 0.05 0.95 50
(vi) Standard 6 1000 ppm 0.10 0.90 100
(k) Sample preparation.-
(i) thoroughly mix or stir products prior to sampling;
(ii) for liquid products, accurately weigh 0.5 to 5 g (±10%) of product into a 50 ml volumetric
flask and record the weight to the nearest 0.0001 g;
(iii) for powdered products that do not require reconstitution, accurately weigh 1.0 gram powder
into a 50 ml volumetric flask and record the weight to the nearest 0.0001 gram;
(iv) add approximately 10 to 15 ml mobile phase to 50 ml volumetric flask and swirl or stir to
completely dissolve the powder and for powdered products that are not homogeneous at the
sub-gram level, reconstitute following the product label instructions and accurately weigh
1.0 gram reconstituted product into a 50 ml volumetric flask and record the weight to the
nearest 0.0001gram;
(v) Make up the volume to 50 ml with mobile phase;
(vi) sonicate it for 30 minutes and filter it through 0.22µ syringe filter; and
(vii) Inject 5µl to HPLC- UV for analysis.
17.3 Procedure
(i) HPLC analysis: following instrument operating conditions specified in table below:
Table (HPLC Conditions)
(i) Column C18(250 mm x 4.6mm); 5 mg (Particle size)
(ii) Detector UV
(iii) Detecting 230 nm
wavelength
(iv) Flow rate 1.0 ml/ min.
(v) Column 20oC
temperature[भाग II—खण्ड 3(ii)] भारत का रािपत्र : असाधारण 79
(vi) Mobile phase A- 20 mM Monobasic phosphate buffer in water, adjust pH to
2.5 with ortho phosphoric acid
B- Methanol: Acetonitrile (60:40)
(vii) Run time 8 minutes
(viii) Injection 5 µl
volume
Table (Gradient)
S. No. Time % B
(i) 0 5
(ii) 2.0 5
(iii) 2.1 25
(iv) 13.0 25
(v) 13.1 90
(vi) 18.0 90
(vii) 18.1 5
(viii) 25.0 5
17.4 Calculation.-
Sample area x Std. concentration x dilution
Vitamin C (mg/kg)=
Std. area x Sample weight
17.5 Reference-
Latef SS 2011. Analysis of ascorbic acid, citric acid and benzoic acid in orange juice. Agilent
Application Solution. Agilent Technologies; Published in USA, September 1, 2011.
18. Estimation of tocopherol (Vitamin E).-
18.1 Equipment.-
(a) HPLC with Column: C18 (150 mm x 4.6mm); 5µ (Particle size).
(b) UV detector.
(c) analytical balance.
(d) 0.22 µ syringe filter.
18.2 Chemicals and Reagent Preparation-
(a) tocopherol(CAS No. 10191-4-0).
(b) acetonitrile (CAS No. 75-05-8).
(c) methanol (CAS No 67- 56-1).
(d) methanol: water (98:2): mix 98 ml of methanol with 2 ml of water.
(e) tocopherol (Vitamin E) stock standard solution: weigh about 50 mg of Tocopherol standard in 50 ml
Volumetric flask and dilute it with 50 ml of methanol and it gives a stock solution of 1000 ppm.
(f) tocopherol intermediate standard solution: dilute 1.0 ml stock standard to 10 ml with methanol and
mix well and it gives an intermediate standard solution of 100 ppm and from this standard solution,
dilute 1.0 ml of intermediate standard solution to 10 ml with methanol and it gives an intermediate
standard solution of 10 ppm.80 THE GAZETTE OF INDIA : EXTRAORDINARY [PART II—SEC. 3(ii)]
(g) prepare linearity point as per sample concentration specified in the table below.
Table
S. No. Linearity Conc. of Volume (ml) Volume (ml) Concentration
standard. stock of stock of water to of standard
solution solution to be used. (mg/ml).
(ppm). be used.
(i) Standard 1 10 ppm 0.10 0.90 1
(ii) Standard 2 10 ppm 0.20 0.80 2
(iii) Standard 3 100 ppm 0.05 0.95 5
(iv) Standard 4 1000 ppm 0.10 0.90 10
(v) Standard 5 1000 ppm 0.05 0.95 50
(vi) Standard 6 1000 ppm 0.10 0.90 100
(h) Sample preparation.-
(i) thoroughly mix or stir products prior to sampling;
(ii) for liquid products, accurately weigh 50 mg of product into a 50 ml volumetric flask and record
the weight to the nearest 0.0001 g;
(iii) for powdered products that do not require reconstitution, accurately weigh 1.0 gram powder
into a 50 ml volumetric flask and record the weight to the nearest 0.0001 gram;
(iv) add approximately 10 to 15 ml methanol to 50 ml volumetric flask and swirl or stir to
completely dissolve the powder and for powdered products that are not homogeneous at the
sub-gram level, reconstitute following the product label instructions and accurately weigh 1.0
gram reconstituted product into a 50 ml volumetric flask and record the weight to the nearest
0.0001 g;
(v) make up the volume to 50 ml with methanol; and
(vi) filter it through 0.22 µ syringe filter.
18.3 Procedure.-
(a) HPLC analysis: following instrument operating conditions specified in table below:
Table (HPLC Conditions)
(i) Column C18 (150 mm x 4.6mm); 5 µ (Particle size).
(ii) Detector UV.
(iii) Detecting wavelength 292 nm.
(iv) Flow rate 1.0 ml/ minutes
(v) Column temperature 25oC.
(vi) Mobile phase 98% Methanol : 2% Water.
(vii) Run time 20 minutes.
(viii) Approximate retention time 10- 15 minutes.
(ix) Injection volume 20 ml.
18.4 Calculation.-
Sample area x standard concentration x dilution
Vitamin E (mg/kg)=
standard area x Sample weight[भाग II—खण्ड 3(ii)] भारत का रािपत्र : असाधारण 81
18.4 Reference.-
Brabcová I, Kovářová L, Šatínský D, Havlíková L and Solich P, 2013, fast HPLC method for
determination of Vitamin E acetate in dietary Supplements using monolithic column. Food Anal.
Methods 6: 380–385.
19. Estimation of thiamine hydrochloride (vitamin b1) -
19.1 Equipment.-
(a) reverse phase LC-18 column (250 mm × 4.6 mm), 5µ particle size.
(b) UV Detector.
(c) analytical balance.
(d) sonicator.
(e) vacuum filtration assembly.
(f) 0.22µ syringe filter.
(g) micropipettes.
19.2 Chemicals and Reagent Preparation.-
(a) pentane sulfonic acid.
(b) glacial acetic acid.
(c) distilled water.
(d) triethylamine.
(e) methanol (CAS No 67- 56-1).
(f) thiamine hydrochloride.
(g) mobile phase.
(i) add 1.8 gram pentane sulfonic acid, 5 ml glacial acetic acid, 0.9 ml of triethyl amine and 265
ml of methanol, make up the volume to 1000 ml with distilled water; and
(ii) sonicate it for forty-five minutes and vacuum filter the buffer and degas before use.
(h) thiamine hydrochloride stock standard solution: weigh about 10 mg of standard in 10 ml volumetric
flask and dissolve it in 1.0- 1.5 ml of acetic acid with heating and make up the volume to 10 ml with
distilled water and it gives a stock solution of 1000 ppm.
(i) thiamine hydrochloride intermediate standard solution: dilute 1.0 ml stock standard to 10 ml with
distilled water and mix well and it gives an intermediate standard solution of 100 ppm and dilute 1.0
ml of intermediate standard solution to 10 ml with distilled water and it gives an intermediate
standard solution of 10 ppm.
(j) prepare the following linearity point as per sample concentration specified in the table below.-
Table
S. No. Linearity Concentration Volume (ml) Volume (ml) Concentration of
standard. of stock of stock of water to be standard (µg/
solution (ppm). solution to be used. ml).
used.
(i) Standard 1 10 ppm 0.10 0.90 1
(ii) Standard 2 10 ppm 0.20 0.80 2
(iii) Standard 3 100 ppm 0.05 0.95 5
(iv) Standard 4 1000 ppm 0.10 0.90 10
(v) Standard 5 1000 ppm 0.05 0.95 50
(vi) Standard 6 1000 ppm 0.10 0.90 100
(k) Sample preparation.-
(i) thoroughly mix or stir products prior to sampling;
(ii) for liquid products, accurately weigh 0.5 to 5 g (±10%) of product into a 50 ml volumetric
flask and record the weight to the nearest 0.0001 gram;
(iii) for powdered products that do not require reconstitution, accurately weigh 1.0 gram powder
into a 50 ml volumetric flask and record the weight to the nearest 0.0001 gram;82 THE GAZETTE OF INDIA : EXTRAORDINARY [PART II—SEC. 3(ii)]
(iv) add approximately 10 to 15 ml mobile phase to 50 ml volumetric flask and swirl or stir to
completely dissolve the powder and for powdered products that are not homogeneous at
the sub gram level, reconstitute following the product label instructions and accurately
weigh 1.0 gram reconstituted product into a 50 ml volumetric flask and record the weight
to the nearest 0.0001 gram;
(v) make up the volume to 50 ml with mobile phase; and
(vi) sonicate it for thirty minutes and filter it through 0.22µ syringe filter.
19.3 Procedure.-
(i) Inject 20 ml of standard or sample to HPLC- UV detector for analysis.
(ii) Chromatographic conditions.-
(a) use reverse phase C-18 column (250 mm x 4.6 mm x 5 µ);
(b) use mobile phase consisting of 1.8 gram pentane sulfonic acid, 5 ml glacial acetic acid, 0.9 ml
of triethylamine and 265 ml of methanol and water to make up the volume to 1000 ml for
isocratic elution;
(c) equilibrate the column at 22 ◦C at the flow rate of 1 ml/minute, use methanol for conditioning
the column;
(d) filter the mobile phase through a 0.22µ membrane filter under vacuum and degas it before use;
(e) use 20 µl for injection into the injector of the HPLC.
(iii) HPLC analysis: following instrument operating conditions specified in table below:
Table (HPLC Conditions)
(i) C olumn C18 (250 mm x 4.6mm); 5µ (Particle size).
(ii) D etector UV.
(iii) D etecting wavelength 230 nm.
(iv) F low rate 1.0 ml/ minute.
(v) C olumn temperature 40oC.
(vi) M obile phase Isocratic elution with mobile phase consisting of
1.8 gram pentane sulfonic acid, 5 ml glacial
acetic acid, 0.9 ml of triethyl amine and 265 ml
of methanol, make up the volume to 1000 ml
with distilled water.
(vii) R un time 8 minutes.
(viii) I njection volume 20µl
19.4 Calculation.-
Sample area x standard concentration x dilution
Vitamin B (mg/kg) =
1
standard area x sample weight
19.5 Reference.-
Marszałł ML, Lebiedzi´nska A, Czarnowski W and Szefer P, 2005., High-performance liquid
chromatography method for the simultaneous determination of thiamine hydrochloride, pyridoxine
hydrochloride and cyanocobalamin in pharmaceutical formulations using coulometric electrochemical
and ultraviolet detection, Journal of Chromatography A, 1094: 91–98
20. Estimation of citric acid -
The method used for estimation of ascorbic acid as detailed in paragraph 16 can be used for estimation
of citric acid except for standard preparation.[भाग II—खण्ड 3(ii)] भारत का रािपत्र : असाधारण 83
The standard preparation is as follows.-
(i) the Citric acid stock standard solution: Weigh about 10 mg of citric acid standard in 10 ml
Volumetric flask and dilute it with 10 ml mobile phase and it gives a stock solution of 1000 ppm.
(ii) prepare linearity point as per sample concentration specified in the table below.-
Table
S. No. Linearity Concentration of Volume (ml) Volume (ml) Concentration of
standard. stock solution of stock of water to be standard
(ppm). solution to be used. (µg/ml).
used.
(i) Standard 1 1000 ppm 1.000 0.000 1000
(ii) Standard 2 1000 ppm 0.750 0.250 750
(iii) Standard 3 1000 ppm 0.500 0.500 500
(iv) Standard 4 1000 ppm 0.250 0.750 250
(v) Standard 5 1000 ppm 0.125 0.875 125
(vi) Standard 6 1000 ppm 0.100 0.900 100
Reference.-
Coppola ED and Starr MS 1986. Liquid Chromatographic Determination of Major Organic Acids in Apple
Juice and Cranberry Juice Cocktail: Collaborative Study. J. Assoc. Off. Anal. Chem. 69: 594- 597.
21. Estimation of α-amylase activity.-
The assay is based on the time required to obtain a standard degree of hydrolysis of a starch solution at
30 ± 0.1°C and the degree of hydrolysis is determined by comparing the iodine colour of the hydrolysate
with that of a standard.
21.1 Equipment.-
(a) spectophotometer.
(b) analytical balance.
(c) fume hood.
21.2 Chemicals and Reagent Preparation.-
(a) cobaltous chloride.
(b) potassium dichromate.
(c) hydrochloric acid.
(d) potassium dihydrogen phosphate (KH PO ).
2 4
(e) dibasic sodium phosphate (Na HPO ).
2 4
(f) iodine.
(g) potassium iodide.
(h) enzyme α-Amylase.
(i) reference colour standard: Prepare a colour standard by dissolving 25.0 gram of cobaltous
chloride (COCI 6H O) and 3.84 gram of potassium dichromate in 100 ml of 0.01 N
2 2
hydrochloric acid and this standard is stable indefinitely when stored in an amber coloured
stoppered bottle.
(j) phosphate buffer pH 6.6.-
(i) solution A: Dissolve 9.1 gram of potassium dihydrogen phosphate (KH PO ) in sufficient
2 4
water to make 1000 ml;
(ii) solution B: Dissolve 9.5 gram of dibasic sodium phosphate (Na HPO ) in sufficient water
2 4
to make 1000 ml; and84 THE GAZETTE OF INDIA : EXTRAORDINARY [PART II—SEC. 3(ii)]
(iii) add 400 ml of Solution A to 600 ml of Solution B, mix, and adjust the pH to 6.6, if
necessary, by the addition of Solution A or Solution B as required.
(k) stock iodine solution: Dissolve 5.5 gram of iodine and 11.0 gram of potassium iodide in about
200 ml of water, dilute to 250 ml with water, and mix, store in a dark bottle, and make a fresh
solution every thirty days.
(l) dilute iodine solution: Dissolve 20 gram of potassium iodide in 300 ml of distilled water, and
add 2.0 ml of Stock Iodine Solution, quantitatively transfer the mixture into a 500 ml
volumetric flask, dilute to volume with water, and mix, prepare daily.
(m) starch substrate solution: Disperse 10.0 gram (dry-weight basis) of starch in 100 ml of cold
water, and slowly pour the mixture into 300 ml of boiling water, boil and stir for one to two
minutes, and then cool while continuously stirring, quantitatively transfer the mixture into a
500 ml volumetric flask with the aid of water, add 10 ml of phosphate buffer pH 6.6, dilute to
volume with water, and mix.
(n) enzyme dilution: prepare an enzyme solution so that 10 ml of the final dilution will give an
end point between 15- 35 under the conditions of the assay.
21.3 Procedure.-
(a) pipet 5.0 ml of dilute iodine solution into a series of glass test tubes, and place them in a water
bath maintained at 30 ± 0.1°C;
(b) pipet 20.0 ml of the starch substrate solution into a 50 ml Erlenmeyer flask, stopper, and
equilibrate for twenty minutes in the water bath at 30°C;
(c) at zero time, rapidly pipet 5.0 ml of the sample preparation into the equilibrated substrate, mix
immediately by swirling, stopper the flask, and place it back in the water bath;
(d) after ten minutes, transfer 1.0 ml of the reaction mixture from the 50 ml flask into one of the
test tubes containing the dilute iodine solution, shake the tube;
(e) mix the solution and compare its OD against the OD of the reference colour at 660 nm against
distilled water as blank and when the reaction nears the end point, an aliquot should be
withdrawn at a regular interval of one minute for comparison with the reference colour
standard OD and the end point is calculated by considering the OD values of the two aliquots
withdrawn (2 minutes apart when the reaction nears end point);
(f) wherein one aliquot has OD higher than the reference colour OD and the other has OD lower
than the reference colour OD) at 660 nm.
Note: The reaction time is noted at the end point and Be certain that the pipet tip does not touch the
iodine solution as carry-back of iodine to the hydrolyzing mixture will interfere with enzyme action
and will affect the results of the determination.
21.4 Calculations.-
(i) One amylase unit (AU) is defined as that quantity of enzyme that will dextrinize starch at the
rate of 1 mg/minute under the specified test conditions;
(ii) Calculate the α-amylase activity of the sample, expressed as AU, by the formula
AU/g= (40 x F)/ T
Wherein,
40 is a factor (400/10) derived from the 400 mg of starch in (20 ml of 2% solution) and the 10 ml of
aliquot of sample preparation used
F is the dilution factor (total dilution volume/sample weight, in grams) and
T is the dextrnising time in minutes and is calculated as
(Higher test OD- Reference colour Standard OD)/60
Calculation at seconds (T)=
(Higher test OD- Lower test OD)/60[भाग II—खण्ड 3(ii)] भारत का रािपत्र : असाधारण 85
21.5 Reference.-
α-Amylase Activity; FAO JECFA monographs; combined compendium of food additive specifications;
joint FAO/WHO expert committee on food additives; Vol 4 analytical methods, test procedures and
laboratory solutions used by and referenced in the food additive specifications pp 119- 120. ISSN 1817-
7077.
22. Estimation of protease activity -
This procedure is used to determine protease activity, expressed as PC units, the assay is based on a thirty
minutes proteolytic hydrolysis of casein at 37°C and pH 7.0, unhydrolyzed casein is removed by filtration,
and the solubilized casein is determined spectrophotometrically.
22.1 Equipment.-
(a) water bath.
(b) spectrophotometer.
(c) pH Meter.
(d) analytical Balance.
(e) automatic Pipetters.
(f) timer.
(g) magnetic stirrer.
22.2 Chemicals and Reagent Preparation
(a) tris (hydroxymethyl) aminomethane.
(b) trichloroacetic acid.
(c) sodium acetate trihydrate.
(d) glacial acetic acid.
(e) hydrochloric acid.
(f) casein.
(g) protease enzyme.
(h) tris buffer (pH 7.0): Dissolve 12.1 gram of enzyme-grade (or equivalent) tris (hydroxymethyl)
aminomethane in 800 ml of water, and titrate with 1N hydrochloric acid to pH 7.0 and transfer
into a 1,000-ml volumetric flask, dilute to volume with water, and mix.
(i) TCA solution: Dissolve 18 gram of trichloroacetic acid and 19 gram of sodium acetate trihydrate
in 800 ml of water in a 1,000-ml volumetric flask, add 20 ml of glacial acetic acid, dilute to
volume with water, and mix.
(j) substrate solution: Dissolve 6.05 gram of tris (hydroxymethyl) aminomethane (enzyme grade) in
500 ml of water, add 8 ml of 1N hydrochloric acid, and mix, dissolve 7 gram of Casein in this
solution, and heat for 30 minutes in a boiling water bath, stirring occasionally and cool to room
temperature, and adjust to pH 7.0 with 0.2N hydrochloric acid, adding the acid slowly, with
vigorous stirring, to prevent precipitation of the casein and transfer the mixture into a 1,000-ml
volumetric flask, dilute to volume with water, and mix.
(k) sample preparation: Using Tris Buffer, prepare a solution of the sample enzyme so that 2 ml of
the final dilution will contain between 10 and 44 PC units.
(l) tyrosine standard preparation: Transfer 100 mg of Tyrosine, previously dried at 105oC for one
hour to 1000 ml volumetric flask and dissolve in 60 ml of hydrochloric acid and make up the
volume with distilled water and the stock solution contains 100 mg of tyrosine in 1.0 ml and
prepare three more dilutions to contain 75, 50 and 25µg of tyrosine per ml as specified in the
table below.-
S. No. Tube ml of stock ml of distilled Concentration
number. solution. water. (mg /ml).
(i) S1 2.5 7.5 25
(ii) S2 5.0 5.0 50
(iii) S3 7.5 2.5 75
(iv) S4 10.0 0.0 10086 THE GAZETTE OF INDIA : EXTRAORDINARY [PART II—SEC. 3(ii)]
22.3 Procedure -
(a) pipet 10.0 ml of the Substrate Solution into test tubes and keep three replicate tubes for enzyme test
samples (mark as T1, T2 and T3), and one tube for blank (mark as B).
(b) equilibrate the tubes for fifteen minutes in a water bath maintained at 37+ 0.1° and following
equilibration to be followed,
(i) rapidly add 2.0 ml of the sample preparation into the tubes with equilibrated substrate solution
(T1, T2 and T3) at zero time, mix the content and place the tubes back to water bath maintained
at 37+ 0.1°; and
(ii) to blank tube (B), add 2 ml of Tris buffer instead of sample preparation, mix the content and
place the tubes back to water bath maintained at 37+ 0.1°.
(c) after exactly thirty minutes of incubation in water bath maintained at 37+ 0.1°, add 10 ml of TCA
solution in all the tubes (T1, T2, T3 and B) to stop the reaction;
(d) for Blank tube (B), add 2 ml of sample preparation after adding TCA, mix the contents rapidly;
(e) place all the tubes back into the water bath for an additional 30 minutes at 37+ 0.1° to allow the
protein to coagulate completely;
(f) at the end of second heating period, shake each tube vigorously and filter through Whatman No. 42
or equivalent and discard the first 3 ml of filtrate. Collect the perfectly clear filtrate;
(g) determine the absorbance of each sample filtrate instrument at zero and obtain the net absorbance by
subtracting blank OD from test OD;
(h) procedure is summarized in the table below:
Table
(i) Test Blank
(ii) Su bstrate solution 5.0 ml 5.0 ml
(iii) Eq uilibrate for 15 min in a water bath maintained at 37+ 0.1°
(iv) Th en add:
(v) En zyme solution 2.0 0.0
(vi) M ix by swirling and incubate in a water bath maintained at 37+ 0.1° C for 30 minutes
(vii) Th en add:
(viii) TC A reagent 10 ml 10 ml
(ix) En zyme solution 0.0 2.0 ml
(x) M ix by swirling and incubate at 37°C for about 30 minutes
(xi) Fi lter through Whatman No. 42 or equivalent
(xii) M easure absorbance of sample against blank at 275 nm
22.4 Calculations-
Unit Definition (PC): One Protease Unit (PCU) is defined as the quantity of enzyme that produce the
equivalent of 1 µg/ml of tyrosine per minute under the conditions of the assay, calculate PC activity using
formula:
Activity (PC/g) = Tyrosine concentration x 22/ 30 x W
Where:
tyrosine concentration in the sample is obtained using the standard curve;
22 is the total volume of the reaction mixture (ml);
30 is the reaction time in minutes; and
W is the weight of the original sample taken in gram.[भाग II—खण्ड 3(ii)] भारत का रािपत्र : असाधारण 87
22.5 Reference-
Protease Activity; FAO JECFA monographs; combined compendium of food additive specifications;
joint FAO/WHO expert committee on food additives; Vol 4 analytical methods, test procedures and
laboratory solutions used by and referenced in the food additive specifications p 147. ISSN 1817- 7077.
23. Estimation of lipase activity-
The method is based on the speed at which the enzyme hydrolyzes tributyrin at pH 7.5, the butyric acid,
which is formed, is titrated with sodium hydroxide and the consumption of the latter recorded as a function
of time.
23.1 Equipment-
(a) pH stat titration system: Use an instrument operating in the pH Stat mode and equipped with a
jacketed titration cell (Radiometer Titralab or equivalent), the instrumental assembly is composed of
a thermoelectric temperature-regulating magnetic stirrer, a motor-driven burette, an automatic
recorder, and a pH meter and the electrical impulses from the pH meter is transferred to the recorder
input, which in turn activate the motor-driven burette through a micro switch to maintain a constant
pH of the assay mixture.
(b) waterbath.
(c) pH electrode.
(d) magnetic stirrer.
23.2 Chemicals and Reagent Preparation
(a) sodium hydroxide.
(b) potassium hydrogen phthalate.
(c) sodium chloride.
(d) monobasic potassium phosphate.
(e) glycerol.
(f) gum arabic.
(g) tris (hydroxymethyl) aminomethane.
(h) tributyrin.
(i) 0.05N sodium hydroxide (NaOH): Dissolve 1.0 gram of sodium hydroxide in water and dilute to 500
ml, standardise the normality by titrating with potassium hydrogen phthalate.
(j) emulsification Reagent: Dissolve 17.9 gram of sodium chloride and 0.41 gram of monobasic
potassium phosphate in about 400 ml of water. Add 540 ml of glycerol, with vigorous stirring, add
6.0 gram of gum Arabic, stir until dissolved and dilute to 1000 ml.
(k) 10 mMTris buffer (pH 8.0): Dissolve 12.1 gram of enzyme-grade (or equivalent) tris
(hydroxymethyl) aminomethane in 800 ml of water, and titrate with 1N hydrochloric acid to pH 8.0
and transfer into a 1,000-ml volumetric flask and make up the volume to 1000 ml with distilled water.
(l) substrate emulsion: Take 15.9 ml of tributyrin into a beaker, add 50 ml emulsion reagent and 235 ml
of water and Sonicate with digital sonifier at 30 amplitude three times for five minutes with five
minutes interval in between each sonication and equilibrate at 30oC in constant temperature bath for
at least fifteen minutes before use use within four hours.
(m) sample and test preparation: Dissolve an accurately weighed amount of the enzyme preparation in
the tris biffer, adjust pH to 8.0, so that it contains between 5000 to 8000 lipase units/ ml and
accurately serial dilute a portion of this solution with water to obtain a final solution containing 0.5
– 1.5 lipase units per ml.
23.3 Procedure.-
(a) fill the titrator burette with 0.05N sodium hydroxide solution;
(b) transfer 15 ml of the substrate emulsion to the 100 ml double walled reaction vessel, equipped with
small stirrer bar and the reaction vessel is placed in a recording pH stat with stirring at 1000 rpm;
(c) the temperature is controlled at 30°C, and the pH is adjusted to 7.0;
(d) add 1-ml amount of the lipase preparation to the reaction mixture previously conditioned to 30oC;
(e) after the reaction is initiated with an aliquot of lipase, there is a drop in the pH due to the release of
butyric acid and the pH meter sends an electrical impulse to the recorder input, which in turn activate88 THE GAZETTE OF INDIA : EXTRAORDINARY [PART II—SEC. 3(ii)]
the motor-driven burette through a micro switch to add standard NaOH (0.05N) to tributyrin mixture
to maintain a constant pH of 7.0 of the assay mixture.
(f) the pH stat record volume of standardized base (0.05N NaOH) consumed versus time; and
(g) stop the titration after a constant (linear) rate of addition is observed for five minutes. (A five minutes
period usually allowed for the determination; volume of the 0.05N NaOH recorded from the digital
readout).
23.4 Calculations.-
Definition of units.-
1-TBU (lipase unit) is the amount of enzyme which releases 1 mol titratable butyric acid per minute
under the given standard conditions.
Calculate the activity of the enzyme preparation by the formula:
LU/g= R x N x 1000/W
where
(i) R is the mean rate of addition of NaOH in the time interval where slope is linear, in
ml/minute;
(ii) N is the normality of the Sodium hydroxide solution;
(iii) 1000 is to convert mM to µM; and
(iv) W is the weight, in grams, of the enzyme preparation contained in 1 ml of the diluted
sample preparation added to 15 ml of substrate emulsion.
23.5 Reference.-
Lipase Activity: food chemicals codex, 11th Ed. committee on codex specifications, food and nutrition
board, division of biological sciences, assembly of life sciences, National Research Council. national
academy press, Washington, DC, 2018.
24. Estimation of 2-bromo-(1h)-indole-3-carboxaldehyde-
24.1 Equipment.-
(a) HPLC- UV system.
(b) analytical balance.
(c) 0.45µ syringe filter.
24.2 Chemicals and Reagent Preparation.-
(a) 2-Bromo-(1H)-indole-3-carboxaldehyde (CAS No. 119910-45-1).
(b) acetonitrile.
(c) standard preparation: accurately weigh 10 mg of 2-Bromo-(1H)-indole-3-carboxaldehyde and
transfer it to 10 ml volumetric flask and make up the volume with acetonitrile to give a stock solution
of 1000µg/ml.
(d) intermediate standard solutions: dilute 1.0 ml stock standard to 10 ml with acetonitrile and mix well
to give an intermediate standard solution of 100 µg/ml, from this intermediate standard solution,
dilute 1.0 ml to 10 ml with acetonitrile to give an intermediate standard solution of 10 µg/ml.
(e) prepare linearity point as per sample concentration specified in the table below-
Table
S. No. Linearity Concentration Volume (ml) Volume Concentration of
standard. of stock of stock (ml) of standard
solution (ppm). solution to be water to be (µg/ml).
used. used.
(i) Standard 1 10 ppm 0.10 0.90 0.11
(ii) Standard 2 10 ppm 0.25 0.75 2.5
(iii) Standard 3 10 ppm 0.50 0.50 5.0[भाग II—खण्ड 3(ii)] भारत का रािपत्र : असाधारण 89
(iv) Standard 4 10 ppm 0.75 0.25 7.5
(v) Standard 5 100 ppm 0.10 0.90 10.0
(f) sample preparation: accurately weigh 5.0 gram of test sample in 20 ml volumetric flask, make up the
volume with acetonitrile and if required, then further dilute the sample, then filter it through 0.45µ
filter.
24.3 Procedure-
(a) inject 20µl of the diluted solution in the HPLC fitted with UV detector.
(b) HPLC Analysis : following instrument operating conditions specified in table below:
Table (HPLC Condition)
(i) Column. C18 (250 x 4.6mm) 5µ particle size
(ii) Detector. UV
(iii) Detecting wavelength. 210 nm
(iv) Flow rate. 0.8ml/min
(v) Mobile Phase. Acetonitrile: 0.1 % Ortho Phosphoric acid in water 60 : 40
(vi) Run Time. 15 Minutes
(vii) Column Temperature. 25 oC
(viii) Injection Volume. 20 µl
24.4 Calculations –
Determination of 2-Bromo-(1H)-indole-3-carboxaldehyde in the test sample in mg/kg according to the
below given formula-
A x V
X1 (mg/kg) =
M
Where,
(i) X1- the content of 2-Bromo-(1H)-indole-3-carboxaldehyde in mg/kg.
(ii) A-the calculated concentration of 2-Bromo-(1H)-indole-3-carboxaldehyde in the test
sample solution in gram/ml.
(iii) V -the volume of the test sample in ml.
(iv) M- the mass of the test sampling.
The percentage (%) of 2-Bromo-(1H)-indole-3-carboxaldehyde in the test sample is calculated using below
formula-
X1 (mg/kg)
2-Bromo-(1H)-indole-3-carboxaldehyde in (%)=
10000
25. Estimation of lipo-chitooligosaccharides-
25.1 Equipment -
(a) calibrated pipettes.
(b) auto sampler vial with screw caps.
(c) centrifuge tubes.
(d) vortex mixer.
(e) sonicatar.90 THE GAZETTE OF INDIA : EXTRAORDINARY [PART II—SEC. 3(ii)]
(f) analytical Balance.
(g) 0.2 µ syringe filter.
25.2 Chemicals and Reagent Preparation -
(a) water.
(b) acetonitrile.
(c) methanol.
(d) dimethyl Sulfoxide.
(e) lipo-chitooligosaccharides (CAS Number 168843-28-5).
(f) 30:70 acetonitrile: water-
(i) add 30 ml of acetonitrile to a clean glass bottle;
(ii) add 70 ml of water to the bottle; and
(iii) cap and mix well to ensure uniformity.
(g) 45:55 acetonitrile: water-
(i) add 45 ml of acetonitrile to a clean glass bottle;
(ii) add 55 ml of water to the bottle; and
(iii) cap and mix well to ensure uniformity.
(h) 50:50 acetonitrile: water-
(i) add 50 ml of acetonitrile to a clean glass bottle;
(ii) add 50 ml of water to the bottle; and
(iii) cap and mix well to ensure uniformity.
(i) 60:40 methanol: water-
(i) add 60 ml of methanol to a clean glass bottle;
(ii) add 40 ml of water to the bottle; and
(iii) cap and mix well to ensure uniformity.
25.3 Standards and QC Solutions-
(A) Stock Standard-
(i) preparation of approximately 0.09 weight % lipo-chitooligosaccharides (LCO) stock standard
solutions is as follows, namely:-
(a) weigh an empty 8 dram (or equivalent) vial to the nearest 0.0001 gram;
(b) weigh a minimum of 0.010 gram of lipo-chitooligosaccharides to the nearest 0.0001 gram into
a dram vial; and
(c) calculate the amount of Dimethyl Sulfoxide needed to add to the vial to get an approximate
concentration of 0.09 weight % lipo-chitooligosaccharides using the following equation-
LCO % purity x gram LCO
0.09 weight % LCO =
gram LCO + gram dimethyl sulfoxide
Note: Input lipo-chitooligosaccharides purity (%) and gram lipo-chitooligosaccharides into the
equation above, solve for gram dimethyl sulfoxide.
(ii) add the calculated amount of dimethyl sulfoxide to the vial;
(iii) weigh final lipo-chitooligosaccharides + Dimethyl Sulfoxide solution to the nearest 0.0001 gram;
(iv) sonicate for five minutes;
(v) vortex a minimum of fifteen seconds;
(vi) repeat steps ‘(iv)’ and ‘(v)’ a minimum of two times, or until solution is clear;
(vii) visually inspect to ensure lipo-chitooligosaccharides has gone into solution;
(viii) the concentration of the Stock standard in weight % is calculated using the following equation:
Stock standard weight % LCO= (grams LCO/grams total solution) x % LCO purity[भाग II—खण्ड 3(ii)] भारत का रािपत्र : असाधारण 91
Example calculation:
(0.0113gram LCO/12.5521 gram total solution) x 87.4% purity = 0.07868 weight % LCO
(ix) Shelf life and storage conditions: the standard stock solution shall be used on the day of
preparation and to be kept away from light when not in use.
(B) Intermediate Standard-
(i) preparation of approximately 0.001 weight % lipo-chitooligosaccharides intermediate standard
solution is as follows:-
(a) weigh an empty 8 dram (or equivalent) vial to the nearest 0.0001 gram;
(b) add approximately 0.22 ml of stock standard to the 8 dram vial;
(c) weigh the 8 dram vial + stock standards to the nearest 0.0001gram;
(d) add approximately 20 ml of 30:70 acetonitrile: water to the 8 dram vial;
(e) weigh final mixture to the nearest 0.0001gram; and
(f) vortex a minimum of fifteen seconds
(ii) The concentration of the intermediate standard in weight % is calculated using the following
equation-
Intermediate Standard weight % LCO = Stock standard weight % LCO x (gram Stock standard /
gram total solution)
Example calculation of Intermediate standard- weight % for stock standard lipo-
chitooligosaccharides concentration of 0.07868 weight % -
0.07868 weight % LCO x (0.2444 gram Stock standard/ 19.3037 gram total solution) = 0.0009962
weight % LCO
(iii) Shelf life and storage conditions: the intermediate standard solution shall be used the day of
preparation and to be kept away from light when not in use.
(C) Working calibration standards-
(i) Working calibration standards are prepared gravimetrically to encompass the range of approximately
0.00004 weight % to 0.0008 weight % lipo-chitooligosaccharides by diluting the intermediate standard
with 30 : 70 Acetonitrile : Water as described below-
(a) for preparation weigh five empty eight dram (or equivalent) vials to the nearest 0.0001 gram
Note: There will be one vial for each of the five working calibration levels;
(b) add the following volumes of Intermediate Standard to the corresponding eight dram vial
specified in the table below:-
Table
S. No. Standard. Intermediate standard (ml).
(i) Standard 5 8.00
(ii) Standard 4 5.00
(iii) Standard 3 3.00
(iv) Standard 2 1.00
(v) Standard 1 0.4092 THE GAZETTE OF INDIA : EXTRAORDINARY [PART II—SEC. 3(ii)]
(c) weigh each vial + intermediate standard to the nearest 0.0001gram;
(d) add the following volumes of 30:70 acetonitrile: water to the corresponding 8 dram vial as
specified in the table below:-
Table:
S. No. Standard. 30:70 acetonitrile: water (ml).
(vi) Standard 5 2.0
(vii) Standard 4 5.0
(viii) Standard3 7.0
(ix) Standard 2 9.0
(x) Standard 1 9.6
(e) weigh each full vial to the nearest 0.0001 gram;
(f) vortex a minimum of fifteen seconds;
(g) transfer 1ml of each standard into a HPLC vial; and
(h) cap vial and analyze via HPLC
(ii) The concentration of the working calibration standard in weight % is calculated using the following
equation:
Working calibration standard weight % LCO = Intermediate Standard weight % LCO x (gram
Intermediate Standard/ gram total solution)
Example calculation of Standard 1: shown using an Intermediate Standard concentration of
0.0010 weight % lipo-chitooligosaccharides-
0.0010 weight % LCO x (7.5200 gram Intermediate Standard/ 9.4000 gram total solution) =
0.0008 weight % LCO
(iii) shelf life and storage condition- the working calibration standards can be stored and used for up to
sixty days under refrigerated temperatures (4oC) and in the dark.
Note: Bring working calibration standards to room temperature and vortex a minimum of fifteen
seconds before opening for future use.
(D) Quality control check standard-
(i) The quality control check standard is diluted directly from the stock standard solution and analyzed
against the working calibration standards, this provides a check on the accuracy of the working
calibration standards.
(a) for preparation weigh an empty eight dram (or equivalent) vial to the nearest 0.0001gram;
(b) add 0.1 ml of stock standard to the eight dram vial;
(c) weigh vial + stock standard to the nearest 0.0001 gram;
(d) add 25 ml of 30:70 Acetonitrile: Water to the eight dram vial;
(e) weigh each full vial to the nearest 0.0001 gram;
(f) vortex a minimum of fifteen seconds;
(g) transfer ~1 ml of each standard into a HPLC vial; and
(h) cap vial and analyze via HPLC
(ii) The concentration of the quality control check standard in weight % is calculated using the
following equation-[भाग II—खण्ड 3(ii)] भारत का रािपत्र : असाधारण 93
Quality control check standard weight % LCO = Stock standard weight % LCO x (gram
Stock standard/gram total solution)
Example calculation: a Quality control check standard is shown using Stock standard
concentration of 0.09 weight % lipo-chitooligosaccharides-
0.09 weight % LCO x (0.1000 gram Stock standard/ 23.6438 gram total solution) = 0.000381
weight % LCO
(iii) Shelf life and storage conditions-the quality control sample can be stored and used for up to sixty
days under refrigerated temperatures (4°C) and in the dark.
NOTE: Bring quality control sample to room temperature and vortex a minimum of fifteen seconds
before opening for future use.
(E) Sample preparation for HPLC-UV -
Sample preparation overview
This method is applicable for the lipo-chitooligosaccharides concentration: 2.5 x 10-5 weight % lipo-
chitooligosaccharides
Overview of sample concentration step is specified in the table below:
Table
S. No. Target lipo- Approximate Dilution Target lipo-
chitooligosaccharides volume of factor after chitooligosaccharides
concentration (weight % sample to apply dilution of concentration at end of
lipo- to solid phase eluted sample preparation for
chitooligosaccharides) extraction fraction HPLC analysis (weight
cartridge (ml) (ml) %)
(i) 2.5 x 10-5 250 2.5 0.00025
25.5 Procedure-
(a) To analyze the active ingredient using HPLC-UV system and standard linearity plots for
quantitative determination;
(b) to prepare the samples for HPLC analysis using solid phase extraction (SPE) to concentrate
lipo-chitooligosaccharides and remove matrix components, which interfere with
chromatography;
(c) the solid phase extraction procedure-
(i) add approximately 250 ml sample to a container;
Note: Ensure sample is homogenous by inverting a minimum of thirty times before
use; and perform duplicate preparations for each batch tested
(ii) weigh sample and container to the nearest 0.01 grams;
(iii) set aside for use later;
(iv) condition by passing 15 ml HPLC grade acetonitrile through SPE cartridges;
Tip: Take care to flow solvent through solid phase extraction cartridges at a dropwise pace
and control the flow rate by adjusting the stopper on the solid phase extraction manifold.
(v) the condition by passing 15 ml HPLC grade methanol through solid phase extraction
cartridges;94 THE GAZETTE OF INDIA : EXTRAORDINARY [PART II—SEC. 3(ii)]
(vi) the equilibrate by passing 15 ml HPLC grade water through solid phase extraction
cartridges;
(vii) obtain weighted samples from step ‘(i)’ to ‘(iii)’;
(viii) to load the 250 ml sample on the solid phase extraction cartridge;
Tip: Control the flow rate so that the sample has enough time to interact with the solid
phase extraction sorbent, the eluate shall be drop-wise.
(ix) once all the sample has been added, weigh the container and sample residue to the nearest
0.01grams;
(x) subtract the weights from step ‘(ix)’ and step ‘(ii)’ to calculate the grams of sample loaded
on the solid phase extraction cartridges;
(xi) wash by passing three 10 ml portions of HPLC Type-1 water through solid phase extraction
cartridges;
(xii) wash by passing three 10 ml portions of 60 : 40 methanol : water through solid phase
extraction cartridges;
(xiii) wash by passing three 10 ml portions of 30 : 70 acetonitrile: water through solid phase
extraction cartridges;
(xiv) wash by passing one 5 ml portion of 45:55 acetonitrile: water through solid phase extraction
cartridges; and
(xv) proceed to the elution step below for the specific lipo-chitooligosaccharides sample
concentration.
(d) 2.5 x 10-5 weight % lipo-chitooligosaccharides solid phase extraction elution and remaining
sample preparation, namely:-
(i) weigh one empty 15ml centrifuge tube for each solid phase extraction cartridge to the
nearest 0.0001grams;
(ii) remove eluate reservoir and replace with 15ml centrifuge tube to collect eluate;
(iii) elute by passing one 10ml portion of 50:50 acetonitrile : water through solid phase
extraction cartridges;
(iv) collect eluted samples in 15ml centrifuge tubes and record weights to the nearest 0.0001
grams;
(v) subtract steps ‘(iv)’ and ‘(i)’ to determine the final sample weight;
(vi) dilute the samples by pipetting 400µl into 600µl 30:70 acetonitrile : water in an auto
sampler vial;
(vii) cap and vortex the diluted sample;
(viii) pass approximately 1ml sample through a 0.2µm filter into a HPLC vial; and
(ix) cap vial, vortex and analyze using HPLC.
(e) final determination by HPLC-UV -
Liquid chromatography method parameters are specified below-
(i) mobile phase A: water;
(ii) mobile phase B: Acetonitrile;
(iii) wash solvent: Acetonitrile;
(iv) column: C18, 4.6 x 250mm, 5 µm;
(v) column oven setting: 50 °C;
(vi) injection volume: 100 µL;
(vii) flow rate: 1.0 ml/minute;
(viii) wavelengths: 200 nm for analysis and quantitation;
(ix) run time: sixty minutes; and
(x) liquid chromatography gradient description specified in the table below:-[भाग II—खण्ड 3(ii)] भारत का रािपत्र : असाधारण 95
Table
S.No. Time (Minutes) % B (Acetonitrile )
(i) 0 30
(ii) 5 30
(iii) 50 50
(iv) 52 100
(v) 53 100
(vi) 54 30
(vii) 60 30
Expected retention time for lipo-chitooligosaccharides is ~45.0 minutes, exact retention time may
change due to chromatographic conditions and should be confirmed with standards for each
analysis.
(f) Calibration procedures-
(i) the calculation of results is based on peak intensity measurements (peak area) using a
calibration curve;
(ii) inject a set of different concentrations of standard solution samples into the HPLC-UV
instrument covering the range of 0.00004 weight % to 0.0008 weight % to obtain the standard
curve;
(iii) obtain the calibration curves by plotting peak area against the concentration of the injected
analyte solutions;
(iv) establish the stability of the detector response by injecting several concentrations of
standards; and
(v) determine the calibration range for a batch by the acceptance criteria, namely:-
(1) 80% of the standards must have back-calculated accuracy within 15% of nominal
concentration; and
(2) the R2 of the regression analysis for the standards must be 0.985 or higher.
25.5 Calculations-
Samples quantified using the external standard curve for lipo-chitooligosaccharides, data from the
calibration standards are fit with a linear regression to obtain a prediction equation for the
concentration determination of lipo-chitooligosaccharides in the HPLC samples, using formula:
x= (y-b)/m
where,
(i) y= peak area of lipo-chitooligosaccharides
(ii) m= slope of calibration curve
(iii) b= intercept of calibration curve
(iv) x= measured concentration of lipo-chitooligosaccharides (weight %) in injected
HPLC sample
Calculations: 2.5 x 10-5 weight % lipo-chitooligosaccharides (LCO) samples-
Use the following calculations to quantify LCO in samples starting with a theoretical concentration
of 2.5 x 10-5 weight % LCO:
(1) Determine weight of sample loaded on solid phase extraction (SPE) cartridge-96 THE GAZETTE OF INDIA : EXTRAORDINARY [PART II—SEC. 3(ii)]
Sample loaded on SPE (gram) = [container sample (gram)] - [container + sample residue (gram)]
Example calculation-
253.22 gram loaded on SPE =526.35 gram full- 273.13 gram empty with residue
(2) Determine weight of final sample prior to HPLC analysis:
Diluted sample weight (gram) = [full 15 ml tube (gram)]–[empty 15 ml tube (gram)]
Example calculation:
8.75123 gram sample = 15.61920 gram full - 6.86797 gram empty
(3) Calculate concentration of LCO (weight %) in each sample:
weight % LCO = (HPLC weight % LCO + [final sample weight (gram)]/ sample loaded on SPE
(gram)]* 2.5
In this equation, the HPLC weight % LCO is the HPLC output and 2.5 is the dilution factor.
Example calculation:
2.56 x 10-5 weight % LCO = (0.000297048 weight % LCO x (8.75123gram/ 253.22gram) x 2.5
26. Estimation of vasicine-
26.1 Equipment-
(a) HPLC.
(b) UV detector.
(c) micro balance.
(d) analytical Balance.
(e) sonicator.
26.2 Chemicals and Reagents required-
(a) Type I water.
(b) HPLC grade Acetonitrile.
(c) orthophosphoric acid.
(d) vasicine (CAS Number: 6159-55-3).
(e) mobile phase-
(i) mobile phase (A): transfer 5ml of orthophosphric acid to a 1000ml of mobile phase bottle
containing Type I water, mix well and sonicate for ten minutes and to be used as a Mobile
Phase-A.
(ii) mobile phase (B): transfer 1000 ml of HPLC grade acetonitrile in to a 1000 ml of mobile phase
bottle and to be used as Mobile Phase- B.
(f) preparation of diluent and blank solution: HPLC grade acetonitrile to be used as diluent and blank
solution.
(g) preparation of reference standard stock and working solution-
(i) weigh 5.0 + 1.0 mg of vasicine standard (of known purity) and transfer it to 5 ml volumetric
flasks;
(ii) add 4 ml of acentonitrile to dissolve the content, make up the volume to 5 ml with acetonitrile
and sonicate for ten minutes, it gives a stock solution of 1000 µg/ml; and
(iii) take 0.1 ml from the above diluted stock solutions and transfer it to a 100 ml of volumetric
flasks and make up the volume with acetonitrile, it gives a working solution of 1 µg/ml.
(h) Preparation of test item stock and working solution-[भाग II—खण्ड 3(ii)] भारत का रािपत्र : असाधारण 97
(i) accurately weigh 880± 10.0 mg of test sample and transfer it in to two different 5 ml volumetric
flasks;
(ii) add 4 ml of acentonitrile to dissolve the content and sonicate for ten minutes; and
(iii) allow the solution to equilibrate to room temperature for ten minutes and make up the volume
to 5 ml with acetonitrile.
26.3 Procedure-
(a) inject 20 µl of the sample or standard into the injector of HPLC.
(b) HPLC analysis: by following conditions as specified in table below:
Table (HPLC Conditions)
(i) Instrument High-Performance Liquid Chromatography
(ii) Column C18 (250 mm x 4.6 mm I.D x 5 um particle size)
(iii) Detector UV
(iv) Mobile phase (A:B) A: 0.5% orthophosphoric acid in water 20% (v/v)
B: acetonitrile 80% (v/v)
(v) Injection Volume 20µl
(vi) Flow rate 0.5 ml/minute
(vii) End time/ Stop time 8.00 minutes
(viii) Wavelength 280 nm
(ix) Column oven Temperature 300 C
(x) Thermostat or Auto Sampler 250 C
Temperature
(xi) Retention time 3.6 minutes
26.4 Calculation-
Area of sample Concentration of
solution standard
x x Standard purity
Active Ingredient = Area of standard Concentration of
solution sample
Vasicine content (ppm) = Vasicine content (% w/w) x 10000
26.5 References-
(i). Srivastava S, Verma RK, Gupta MM , Singh, and Kumar S 2001. HPLC determination of vasicine
and vasicinone in Adhatoda vasica with photo diode array detection. Journal of Liquid
Chromatography and related technologies 24: 153–159
(ii). Martolia J, Soni H and Tandel F 2021. In Vitro anti tubercular activity and physicochemical
standardization of selected medicinal plant extracts. Indian Journal of Pharmaceutical Sciences 83:
230-237
27. Enumeration of Methylococcus capsulatus-
Methylococcus capsulatus is an obligate methanotroph, which requires methane (CH ) for its growth, this
4
bacteria grows in Nitrate mineral salt medium when incubated in an atmosphere containing 50% air: 50%
CH , the growth temperature ranges from 37-40℃.
4
27.1 Equipment-
(a) weighing balance.98 THE GAZETTE OF INDIA : EXTRAORDINARY [PART II—SEC. 3(ii)]
(b) pH meter.
(c) water bath.
(d) autoclave.
(e) hot air oven.
(f) biosafety cabinet or laminar airflow chamber.
(g) incubators.
(h) colony counters.
27.2 Growth medium and diluents-
(a) growth medium: Nitrate Mineral Salt (NMS) medium and modified by American Type Culture
Collection and the following table specified the composition of Nitrate mineral salt medium,
namely:-
(i) Composition of Nitrate mineral salt (NMS) medium is specified in table below:
Table
S.No. Ingredient Amount
(i) MgSO .7H O 1.0 gram
4 2
(ii) CaCl .6H O 0.20 gram
2 2
(iii) *Chelated Iron Solution 2.0 ml
(iv) KNO 1.0 gram
3
(v) **Trace Element Solution 0.5 ml
(vi) Agar 15.0 gram
(vii) Distilled Deionized Water 1.0 litre
(viii) Adjust pH to 6.8-7.0
* Chelated iron solution to be prepared following as specified in table below-
Table
S. No. Ingredient Amount
(i) Ferric (III) ammonium citrate 0.1 gram
(ii) EDTA, sodium salt 0.2 gram
(iii) HCl (concentrated) 0.3 ml
(iv) Distilled Deionized Water 100.0 ml
(Optional: 0.05 gram Ferric (III) chloride may be substituted)
** Trace Element Solution to be prepared following as specified in table below -
Table
S. No. Ingredient Amount
(i) EDTA 500.0 mg
(ii) FeSO . 7H O 200.0 mg
4 2
(iii) ZnSO . 7H O 10.0 mg
4 2
(iv) MnCl . 4H O 3.0 mg
2 2
(v) H BO 30.0 mg
3 3
(vi) CoCl . 6H O 20.0 mg
2 2
(vii) CaCl . 2H O 1.0 mg
2 2
(viii) NiCl . 6H O 2.0 mg
2 2
(ix) Na MoO . 2H O 3.0 mg
2 4 2[भाग II—खण्ड 3(ii)] भारत का रािपत्र : असाधारण 99
(x) Distilled water 1.0 Litre
(ii) Autoclave the medium for 20 minutes at 121oC; and
(iii) Post autoclave additions: Add 2 ml/litre *phosphate buffer (pH 6.8) to the autoclaved medium.
* For phosphate buffer, pH 6.8 (gram/liter), add 3.6 gram of Na HPO and 1.4 gram of KH PO to 1
2 4 2 4
liter of water and autoclave, autoclaved phosphate buffer stock solution should be stored at 4-8oC
(refrigeration).
(b) Diluents: Physiological saline (0.9% sodium chloride) - Add 0.9 gram of NaCl to 100 ml of water.
27.3 Procedure-
(a) prepare the Nitrate Mineral Salt (NMS) medium in accordance with the composition and autoclave
it at 121℃ for twenty minutes;
(b) after autoclaving the medium, add 2 ml of the autoclaved phosphate buffer to 1 litre of the medium
and let the medium cool to 45-50oC;
(c) pour about 15-20 ml of medium into petri plates in a laminar flow bench;
(d) dispense 10 gram of biostimulant formulation to 90 ml of autoclaved physiological saline in 250
ml conical flask and shake for thirty minutes on shaker at 150 rpm, this gives 10-1 dilution of the
sample;
(e) prepare nine tubes each containing physiological saline and autoclave and cool it;
(f) transfer 1 ml of aliquot from 10-1 dilution to a tube with 9 ml of physiological saline, this gives 10-
2 dilution and likewise make serial dilutions up to 10-10 each time transferring 1 ml to 9 ml of
physiological saline;
(g) spread plate 0.1 ml of serially diluted sample on Nitrate Mineral Salt agar plate and incubate the
plates in desiccators with an atmosphere of 50% air and 50% methane for 4-5 days and keep the
desiccators in an incubator maintained at 37+2oC.
(h) observe the plates for growth after five days and count the number of colonies that shows the
following colony morphology, namely:-
(i) the edge of typical Methylococcus capsulatus is entire, and the colony surface appears
smooth and shiny;
(ii) the colony shape is circular, and the elevation is convex; and
(iii) the colony color is off-white, with semi-translucent opacity.
27.4 Calculation-
Colony forming unit (CFU per gram) = N x Dilution factor x 10
[Example: 201 colonies appeared in 10-6 dilution, the CFU per gram will be = 201 x 106 x 10=2.01 x
109]
27.5 Reference-
Whittenbury, R., Davies, S. L. & Wilkinson, J. F. (1970) Enrichment, isolation and some properties of
methane-utilizing bacteria. Journal of General Microbiology, 61, 205–218.
28. Enumeration of Methylobacterium symbioticum and Methylobacterium extorquens-
28.1 Equipment
(a) weighing balance.
(b) pH meter.
(c) water bath.
(d) autoclave.
(e) hot air oven.
(f) biosafety cabinet/Laminar air flow chamber.
(g) incubators.
(h) colony counters.100 THE GAZETTE OF INDIA : EXTRAORDINARY [PART II—SEC. 3(ii)]
28.2 Growth medium and diluents-
(a) Growth medium- prepare Ammonium mineral salt agar medium as per the composition specified in table
below, autoclave it and add 5 ml of Methanol to one litre of medium.
(i) Composition of Ammonium mineral salt medium:
Table
S. No. Ingredient Amount
(i) K HPO 0.70 gram
2 4
(ii) KH PO 0.54 gram
2 4
(iii) MgSO . 7H O 1.0 gram
4 2
(iv) CaCl . 2H O 0.2 gram
2 2
(v) FeSO . 7H O 4 mg
4 2
(vi) NH Cl 0.5 gram
4
(vii) ZnSO .7 H O 0.10 mg
4 2
(viii) MnCl . 4H O 0.03 mg
2 2
(ix) H BO 0.3 mg
3 3
(x) CoCl . 6H O 0.2 mg
2 2
(xi) CuCl . 2H O 0.1 mg
2 2
(xii) NiCl . 6 H O 0.02 mg
2 2
(xiii) Na MoO . 2 H O 0.06 mg
2 4 2
(xiv) Adjust pH to 6.8
(b) Diluent: Physiological saline (0.9% sodium chloride)- Add 0.9 gram of NaCl to 100 ml of water.
28.3 Procedure
(a) prepare the AMS medium in accordance with the composition and autoclave it at 121oC for twenty
minutes;
(b) after autoclaving the medium, add 5 ml of methanol to 1 litre of the medium, let the medium cool to
45-50oC;
(c) pour about 15- 20 ml of medium into petri plates in a laminar flow bench;
(d) dispense 10 gram of biostimulant formulation to 90 ml of autoclaved physiological saline in 250 ml
conical flask and shake for thirty minutes on shaker at 150 rpm. And this gives 10-1 dilution of the
sample;
(e) prepare 9 tubes each containing physiological saline and autoclave and cool it;
(f) transfer 1 ml of aliquot from 10-1 dilution to a tube with 9 ml of physiological saline, this gives 10-2
diltuion and likewise, make serial dilutions up to 10-9 each time transferring 1 ml to 9 ml of
physiological saline;
(g) spread plate 0.1 ml of serially diluted sample on NMS agar plate and incubate the plates in an
incubator maintained at 30+2oC; and
(h) observe the plates for growth after 5- 8 days, count the number of colonies that are small and pink in
colour.
28.4 Calculation-
Colony forming unit (CFU per g) = N x Dilution factor x 10
28.5 Reference-
Whittenbury, R., Davies, S. L. & Wilkinson, J. F. (1970) Enrichment, isolation and some properties of
methane-utilizing bacteria. Journal of General Microbiology, 61, 205–218.[भाग II—खण्ड 3(ii)] भारत का रािपत्र : असाधारण 101
29. Molecular identification of bacterial cultures-
29.1 Equipment-
(a) water bath.
(b) refrigerated Microcentrifuge.
(c) vortex mixer.
(d) UV- Vis Spectrophotometer.
(e) thermal cycler.
(f) gel documentation system.
(g) DNA sequencer.
29.2 Chemicals and Reagent Preparation-
(a) tris(hydroxymethyl) aminomethane.
(b) ethylenediaminetetraacetic acid (EDTA).
(c) sodium Dodecyl Sulphate (SDS).
(d) phenol.
(e) chloroform.
(f) sodium acetate.
(g) ethanol.
(h) tris- EDTA (TE) buffer.
(i) Taq polymerase
(j) 10X Taq Polymerase Buffer
(k) dNTPs.
(l) primer F- pA (5'-AGAGTTTGATCCTGGCTCAG-3').
(m) primer R - pH (5'AAGGAGGTGATCCAGCCGCA-3').
(n) nuclease free water.
(o) 6X loading buffer (Mix 3.4 ml glycerol, 25 milligram bromophenol blue, 25 mg xylene cyanol
FF and 6.7 ml dist. H O).
2
(p) ethidium bromide.
(q) agarose.
(r) horizontal gel electrophoresis system.
(s) power pack.
(t) sequence buffer.
(u) TRR – Terminator Ready Reaction: A, G, C, T dye terminator labeled with d-Rhodamine dye,
dNTPs, Taq polymerase, MgCl and Tris-HCl buffer (pH – 9.0)
2
(v) Loading buffer [formamide:25 mM EDTA (4:1)].
(w) big - Dye terminator kit.
(x) gel purification kit.
29.3 Procedure
(A) Preparation of template DNA
(a) take one loopful of bacterial from the agar plates and suspended in 0.4 ml Tris EDTA buffer in a
1.5 ml micro-centrifuge tube;
(b) to this add 40 µl of 10 per cent SDS and incubate for 30 minutes at 37oC in a water bath with
gentle shaking;102 THE GAZETTE OF INDIA : EXTRAORDINARY [PART II—SEC. 3(ii)]
(c) add 0.40 ml Phenol and mix well;
(d) centrifuge the tube containing this suspension for five minutes at 8000 rpm;
(e) collect the aqueous phase with the help of a micropippete and transfer it to a new tube;
(f) add to the aqueous phase 0.20 ml of Phenol and 0.20 ml Chloroform and mix well without
vortexing;
(g) centrifuge the suspension for five minutes at 8000 rpm;
(h) collect the aqueous phase and transfer it to another fresh tube;
(i) to it add 0.4 ml chloroform and mix without vortexing and centrifuge at 8000 rpm for five minutes
and collect the aqueous phase in a fresh tube;
(j) to it add 0.1 volume of 3M Sodium Acetate, pH 5.2 and mix well;
(k) add 2 volume of 96 per cent ethanol and keep it at -200C for one hour;
(l) centrifuge the contents for ten minutes at 8000 rpm;
(m) decant the supernatant and the pellet in the tube is the DNA;
(n) wash the DNA pellet with cold 70 per cent ethanol and centrifuge for ten minutes at 8000 rpm;
(o) discard the supernatant;
(p) suspend the dried pellet in 40 µl TE buffer and store at 4oC; and
(q) quantify the DNA using spectrophotometer at 260 nm (1 OD= 50.0 ng DNA per µL)
(B) PCR amplification of 16S rRNA gene and gel electrophoresis
(a) amplify the 16S rRNA gene by mixing the genomic DNA (50-100 nano gram) with universal
primers pA (5'-AGAGTTTGATCCTGGCTCAG-3') and pH
(5'AAGGAGGTGATCCAGCCGCA-3'), buffer, dNTPs and Taq polymerase;
(b) add the reagents in the required volume in a 0.2 ml PCR tube as per the following specified in
table below;
Table
Stock Working Volume per
S. No Components
solution solution reaction
10X Taq Polymerase
(i) Buffer 10 X 1 X 5 µl
(ii) dNTP 10 mM 0.2 mM 1 µl
(iii) Primer F (pA) 50 pM 1.5 pM 1.5 µl
(iv) Primer R (pH) 50 pM 1.5 pM 1.5 µl
(v) Taq polymerase 3 U/µl 1.5 U 0.5 µl
(vi) DNA 4 µl
(vii) Nuclease free water 36.5 µl
(viii) Total 51 µl
(c) carry out all the operations on ice;
(d) in addition to the samples, maintain the negative control (i.e without template DNA)
simultaneously to check for possible contamination.
(e) cap all the PCR tubes and vortex to mix. Pulse the tubes for 2-3 seconds in a microcentrifuge
to pool the contents in the bottom.
(f) carry out DNA amplification in Thermal Cycler with the following temperature profile- initial
incubation at 94oC for five minutes followed by 35 cycles (94oC for one minute, 52.5oC for
one minute, and 72oC for two minutes) and final extension at 72oC for ten minutes using
thermal cycler;
(g) after completion of PCR, mix an appropriate aliquot (2-3 µl) with 0.5 µl of 5X loading buffer
and load into the 1% agarose gel containing ethidium bromide (with a final concentration of
0.2–0.5 mg / ml); and
(h) separate the amplified DNA fragment by running the gel at 60 Volt/cm for one and a half[भाग II—खण्ड 3(ii)] भारत का रािपत्र : असाधारण 103
hours and visualize under UV light using a gel documentation system.
(C) Sequencing of 16S rRNA gene-
(a) cut the gel precisely with the 16S rDNA fragments and remove it from the gel;
(b) using any commercially available PCR/Gel purification kit and following the manufacturer’s
protocol, elute and purify the DNA.
(c) use the purified PCR product for sequencing PCR with the following primers
8-27F - 5'AGAGTTTGATCCTGGCTCAG-3'
1492R - 5'-GGT TACCTTGTTACGACTT-3'
(d) The protocol for sequencing PCR is specified in the following table:-
Table
S. No Components Stock solution Volume/reaction
(i)
Sequence Buffer 5 X 1.5 µl
(ii)
Primer 2 pM 1.5 µl
(iii)
Nuclease free water 3.0 µl
(iv)
DNA 3.0 µl
(v)
TRR 1.0 µl
(vi) Total 10 µl
TRR – Terminator Ready Reaction: A, G, C, T dye terminator labeled with d-Rhodamine dye,
dNTPs, Taq polymerase, MgCl and Tris-HCl buffer (pH – 9.0)
2
(e) carry out cycle sequencing in a PCR machine for 35 cycles with the following conditions: Initial
denaturation at 96oC for one minute followed by 25 cycles of sequencing and each cycle consists
of a denaturation step at 96oC for thirty seconds, an annealing step at 52oC for fifteen seconds
and an extension step at 60oC for four minutes, Finally hold at 4˚C until ready to purify;
(f) after the PCR, precipitate the products by incubating on ice for fifteen minutes using 1 µl of 3
M sodium acetate (pH 4.6) and 50 µl of ethanol;
(g) recover the pellet by centrifugation at 15000 rpm for twenty minutes at 4⁰C and wash the pellet
with 70% ethanol, dry it under vacuum, and dissolve in 10 µl of loading buffer [formamide:25
mM EDTA (4:1)]; and
(h) determine the rDNA sequence by the dideoxy chain-termination method using the mix from the
Big Dye Terminator sequencing kit in a total volume of 10 μl,.using Genetic Analyzer.
(D) Molecular identification using the 16S rRNA gene sequence
The full length 16S rDNA sequences of the bacteria are compared with sequences available at NCBI
database by the BLAST search available in the database to identify the nearest taxa.
30. Estimation of pesticide residues contamination -
30.1 Equipment -
(1) centrifuge Low Volumes.
(2) GCMS/MS.
(3) LCMS/MS.
(4) analytical balance 0.01mg.
30.2 Chemicals and Reagent Preparation-
(a) ethyl acetate (AR Grade)
(b) sodium sulphate anhydrous: - Heated for four hours at 6500C.
(c) methanol: - LCMS grade.
(d) ammonium acetate AR grade104 THE GAZETTE OF INDIA : EXTRAORDINARY [PART II—SEC. 3(ii)]
(e) primary secondary amine (PSA)
(f) standard preparation -
(i) stock solution of individual pesticide, weigh individual certified reference standards around
10 mg in 10 ml volumetric flask and dissolve in Methanol for LCMS/MS and in Ethyl acetate
for GCMS-MS and the concentration of pesticide in this stock solution is 1000 mg/kg;
(ii) intermediate standard solutions, from stock solution (1000 mg/kg) , prepare standard solution
of 100 mg/ kg by pipetting required volume in 10 ml volumetric flask and make up to the mark
with appropriate solvent (Methanol for LCMS/MS and Ethyl Acetate for GCMS/MS);
(iii) mixture of pesticide standards (1µg/ml), from each of individual standard stock solution (100
mg/kg), pipette out required volume of standard solution to 25ml/50ml / 100ml volumetric flask,
to prepare the mixture of pesticides having concentration 1.0 µg/ml; and
(iv) preparation of linear dilutions, pipette out required volume of stock solutions from step ‘(iii)’
to 5ml volumetric flasks for the different five levels of dilutions and make up to the mark with
appropriate solvent.
30.3 Procedure-
30.3.1. For LCMS/MS Extraction-
(i) sample weight: weigh 1 gram of sample in a 15 mL centrifuge tube and add 10 ml of methanol to
the sample and shake the sample vigorously for thirty seconds and vortex for thirty seconds and
sonicate the sample for ten minutes.
(ii) dilution-1: pipette out 1ml of extract from step ‘(i)’ in to a 10 ml standard volumetric flask and
make up the volume to the mark by using methanol and water (50 : 50)
(iii) clean-up: add 25 mg of Primary secondary amine in a 2 ml micro centrifuge tube and pipette out
1.0 ml of sample extract and vortex for thirty seconds.
(iv) low volume centrifugation: centrifuge the sample in a refrigerated centrifuge for five minutes at
10000 rpm at -10° C;
(v) filtration: take supernatant after centrifugation and filter the supernatant through 0.2µ membrane
filter in to a 2 ml glass vial; and
(vi) sample injection: inject 5 µL filtrate in LCMS/MS using chromatographic conditions given in
Table-1.
30.3.2 For GCMS/MS Extraction -
(i) weigh 1 gram of sample in 15 ml tube, add 10 mL ethyl acetate to the sample and vigorously
shake the sample solution for thirty seconds, vortex for thirty seconds and sonicate for ten
minutes,
(ii) dilution-1: pipette out 1ml extract from step ‘(i)’ in to a 10 ml standard volumetric flask and make
up the volume to the mark by ethyl acetate;
(iii) clean-up: pipette out 1 ml of sample extract and add 25 mg of primary secondary amine (PSA)
and 150 mg Na SO in a 2 ml centrifuge tube and vortex for thirty seconds;
2 4
(iv) centrifugation: centrifuge the sample in a refrigerated centrifuge for five minutes at 10000 rpm at
-10°C;
(v) filtration: take supernatant after centrifugation and filter the supernatant through 0.2µ membrane
filter in to a 2 ml GC vial; and
(vi) sample injection: inject 1µl filtrate in GCMS/MS using chromatographic conditions specified in
the Table-2.
30.3.3 Sequence of injections
(i) inject reagent blank;
(ii) inject one standard of suitable concentration within calibration range;
(iii) inject reagent blank;
(iv) inject samples;
(v) after every six samples inject standard of suitable concentration within calibration range.[भाग II—खण्ड 3(ii)] भारत का रािपत्र : असाधारण 105
30.4 Calculation
Concentration of Pesticide (%) = Area of sample Conc. of standard DF
x x
Area of standard Wt. of sample 104
where,
DF = Dilution Factor =100
Table -1 (LC-MS-MS Condition)
Column Acquity UPLC®BEH-C18, 1.7µm [100 mm]
Mobile phase Mobile phase A: water with10mM ammonium acetate and 0.1% formic acid:
methanol (98:2)
Mobile phase B: methanol with 0.1% formic Acid
Flow rate 0.35 ml/minute
Mobile phase programming
Time Flow
(ml/minute)
(100 mm %A %B Curve
column)
Initial 0.35 95.0 5.0 Initial
0.25 0.35 95.0 5.0 6
5.00 0.35 50.0 50.0 6
10.00 0.35 37.5 62.5 6
10.05 0.35 20.0 80.0 6
13.00 0.35 20.0 80.0 6
16.00 0.35 5.00 95.0 6
17.50 0.35 95.0 5.0 6
22.00 0.35 95.0 5.0 6
MS/MS Condition
Source Dissolution Capillary voltage RF lens Dissolvation gas Cone gas flow
temperature temperature (kV) flow
[V] (liter/hour)
(0C)
(0C)
(liter/hour)
120 350 3.0 0.1 1000 50
List of pesticides to be analyzed on LC-MS-MS
S. No Name of the Pesticide Parent ion (Q1) Quantifier ion (Q2) Qualifier ion (Q3)
(1) 6-Benzyl Adenine 226.01 90.95 65.01
(2) Abamectin 890.34 567.31 305.26
(3) Acephate 184.1 143.0 125.1
(4) Acetamiprid 223.0 126.0 56.1
(5) Azoxystrobin 404.0 372.0 329.0
(6) Aldicarb 191.1 116.0 89.0
(7) Ametryn 228.0 68.0 95.9
(8) Bendiocarb 224.1 167.0 109.0
(9) Benfuracarb 411.2 195.0 252.0106 THE GAZETTE OF INDIA : EXTRAORDINARY [PART II—SEC. 3(ii)]
S. No Name of the Pesticide Parent ion (Q1) Quantifier ion (Q2) Qualifier ion (Q3)
(10) Bensulfuron-Methyl 411.0 149.0 182.0
(11) Bitertenol 338.1 99.1 70.1
(12) Buprofezin 306.1 201.0 57.4
(13) Carbaryl 202.0 145.0 117.0
(14) Carbendazim 192.1 160.1 132.1
(15) Carbofuran 222.1 165.1 123.0
(16) Carbofuran-3-Hydroxy 238.0 163.0 181.0
(17) Carboxin 236.0 143.0 87.0
(18) Carfentrazone Ethyl 414.0 368.0 348.0
(19) Capropamid 334.0 139.0 195.9
(20) Chlorantraniliprole 481.8 111.8 283.6
(21) Chlormequat Chloride 122.2 62.9 59.1
(22) Chlorpropham 214.1 172.0 154.0
(23) Clothianidin 250.0 169.0 132.0
(24) Cymoxanil 199.0 128.0 111.0
(25) Cyproconazole 292.0 70.0 124.9
(26) Diafenthiuron 385.3 278.3 329.2
(27) Difenconazole 406.0 251.1 111.1
(28) Dimethoate 230.1 199.0 125.0
(29) Dimethomorph 388.1 301.0 165.0
(30) Dinotefuran 203.0 129.0 113.0
(31) Emamectin Benzoate 886.6 158.0 126.0
(32) Ethiprole 398.93 256.9 352.9
(33) Ethoxy Sulfuron 398.9 261.0 218.0
(34) Fenamidone 312.1 92.0 236.1
(35) Fenazaquin 307.1 57.0 161.0
(36) Fenobucarb 208.0 94.9 152.0
(37) Fenoxaprop-Ethyl 362.1 288.0 121.1
(38) Flonicamide 230.0 202.9 173.9
(39) Fluopyram 397.1 173.0 208.0
(40) Fenpyroximate 422.2 366.1 138.1
(41) Flubendiamide 680.9 253.9 273.8
(42) Flufenoxuron 489.1 158.0 141.0
(43) Flusilazole 316.0 247.0 165.0
(44) Hexazinone 253.0 171.1 71.0
(45) Hexythiazox 353.0 168.1 228.1
(46) Imidacloprid 256.1 175.1 209.1
(47) Indoxacarb 528.0 150.0 203.0
(48) Iprovalicarb 321.1 119.0 203.1
(49) Isoproturon 207.1 72.0 46.0
(50) Linuron 249.1 160.1 181.1[भाग II—खण्ड 3(ii)] भारत का रािपत्र : असाधारण 107
S. No Name of the Pesticide Parent ion (Q1) Quantifier ion (Q2) Qualifier ion (Q3)
(51) Lufenuron 508.9 338.8 174.8
(52) Malaoxon 315.2 99.0 127.0
(53) Malathion 331.0 99.0 127.0
(54) Mandipropamid 412.0 327.9 124.8
(55) Mepiquat Chloride 114.2 58.0 98.0
(56) Metalaxyl 280.1 220.1 192.1
(57) Methamidaphos 141.9 94.0 110.0
(58) Methomyl 163.0 88.0 64.9
(59) Metolachlor 284.1 252.1 176.1
(60) Metribuzin 215.0 89.1 131.0
(61) Monocrotophos 224.1 127.1 98.1
(62) Myclobutanil 289.1 70.2 125.0
(63) Novaluron 492.9 157.9 140.9
(64) Omethoate 214.1 125.1 183.1
(65) Oxadiazon 247.1 169.0 109.0
(66) Paclobutrazole 294.0 69.9 124.8
(67) Penconazole 284.0 70.1 159.0
(68) Pencycuron 329.1 125.1 124.9
(69) Phosmet 317.9 160.0 77.0
(70) Phosphomidon 300.1 127.1 174.1
(71) Pretillachlor 312.1 252.1 176.1
(72) Propanil 217.9 161.9 127.0
(73) Propiconazole 342.0 69.0 159.0
(74) Pyriproxyfen 322.1 96.0 227.1
(75) Simazine 202.0 124.0 96.0
(76) Spinetoram 748.3 142.1 98.0
(77) SpinosadA 732.6 142.0 98.0
(78) Spinosad-D 732.6 142.0 98.1
(79) Spirotetramat 371.1 216.1 302.1
(80) Tebuconazole 308.0 70.1 125.0
(81) Tetrachlorvinfos 366.85 126.92 240.78
(82) Tetraconazole 372.0 159.0 70.1
(83) Thiacloprid 253.0 126.0 90.1
(84) Thiamethaxam 292.0 211.2 132.0
(85) Thiobencarb 258.0 125.0 100.0
(86) Thiodicarb 355.0 87.9 107.9
(87) Thiophanate Methyl 343.0 151.0 93.0
(88) Tolfenpyrad 384.0 91.0 197.1
(89) Triadimefon 294.1 69.3 197.2
(90) Triadimenol 296.1 70.2 99.1
(91) Tridemorph 257.0 109.0 79.0108 THE GAZETTE OF INDIA : EXTRAORDINARY [PART II—SEC. 3(ii)]
S. No Name of the Pesticide Parent ion (Q1) Quantifier ion (Q2) Qualifier ion (Q3)
(92) Tricyclazole 190.0 163.0 136.0
(93) Trifloxystrobin 409.0 186.0 145.0
Table -2 (GC Condition)
Oven Temperature Rate/ minute Temperature Hold time (minute)
Programme
0.0 700C 1.0
700C 1800C 3.0
200C 2200C 9.0
80C 2800C 9.0
Injector Temperature Rate / minute Temperature Hold time (minute)
Programme
0.0 750C 0.1
4500C 3250C 5.0
100C 2500C 0.0
Column DBP-5MS, 30m, 0.25mm, 0.5µ
Column flow 1.7 ml/ minute
Transfer line 280oC
Temperature
Mass range 50 to600
MS Condition:
Source Temperature MS1Quad. MS2Quad. Collision Flow Quench Flow
Temperature
Temperature
2900C 1500C 1500C 1.5 ml/minute 2.5 ml/minute
List of pesticides to be analyzed on GCMS
S. No. Name of Pesticide Parent Ion Quant Ion Qualifier Ion
(Q1) (Q2) (Q3)
1. 2 4DDT 234.7 165 199
2. 44 DDD 234.8 165 199
3. 44 DDE 245.7 176 211
4. 44DDT 234.7 165 199
5. 2,4,DDD 235 199 165
6. 2,4DDE 245.8 211 175.6
7. Alachlor 187.8 160 131
8. Aldrin 262.6 192.8 191
9. Allethrin 122.7 81.1 79.1
10. Alpha HCH 180.8 109 111
11. Anilofos 225.5 184 157[भाग II—खण्ड 3(ii)] भारत का रािपत्र : असाधारण 109
S. No. Name of Pesticide Parent Ion Quant Ion Qualifier Ion
(Q1) (Q2) (Q3)
12. Atrazine 214.8 58 200
13. Beta–HCH 180.8 145 109
14. Bifenazate 299.7 214.1 199
15. Bifenthrin 180.8 165 166
16. Boscalid 140 112 76
17. Bromuconazole 172.8 145 109
18. Butachlor 175.8 147 134
19. Captan 79 51 77
20. Chlorobenzilate 251.1 139.1 75.1
21. Chlorfenvinphos 266.7 159 81
22. Chlorpyrifos 213.6 258 286
23. Chlorpyrifosmethyl 285.7 93 271
24. Clomazone 124.5 99 88.1
25. Cyfluthrin 162.8 127 109
26. Cypermethrin 180.7 152 127
27. Cypermethrin Alpha 180.7 152 127
28. Delta HCH 218.8 183 147
29. Deltamethrin 252.8 73 174
30. Dicofol 138.9 111 75
31. Dichlorovos 184.8 93 109
32. Diazinon 303.8 179 166.7
33. Dieldrine 262.7 193 191
34. Diflubenzuron 156.9 141.1 113.1
35. Dimefluthrin 122.8 80.9 67
36. Dimethoate 124.9 47 79
37. Diflufenican 265.8 246.1 238
38. Edifenphos 173 109 65
39. Endosulfan-alpha 240.7 206 204
40. Endosulfan-beta 240.7 205.8 169.8
41. Endosulfan Sulphate 271.6 236.8 234.7
42. Endrin 263 193 191
43. Epoxyconazole 192 138 111
44. Ethion 230.7 129 175110 THE GAZETTE OF INDIA : EXTRAORDINARY [PART II—SEC. 3(ii)]
S. No. Name of Pesticide Parent Ion Quant Ion Qualifier Ion
(Q1) (Q2) (Q3)
45. Ethofenprox 163 107.1 135.1
46. Ethofumesate 285.9 179 161
47. Etoxazole 141 113 63.1
48. Fenitrothion 276.7 260 125
49. Fenpropathrin 180.8 152 127
50. Fenthion 124.8 79 47
51. Fenvalerate 166.9 125 89
52. Fluvalinate 249.7 55 208
53. Fipronilsulfone 212.7 178 143
54. Fipronil 366.6 254.9 212.9
55. Floraxy 1 Methyl Heptyl Ester 208.9 181 160.9
56. FluazifopPButyl 281.8 238.1 91
57. Fluchloralin 306 264 206
58. Flufenacet 150.8 136.1 95
59. gama HCH/ Lindane 180.8 145 109
60. Heptachlor 271.6 236.8 235
61. Hexaconazole 213.7 159 187
62. Isoprothiolane 289.7 204 118
63. Lambda Cyhalothrin 180.8 152 127
64. Meperfluthrin 162.8 126.8 90.9
65. MethylParathion 263 109 246
66. Parathionethyl 290.9 109 81
67. Pendimethalin 252.1 162.1 191
68. Permethrin 182.8 168 153
69. Phenol4-bromo-2-chloro- 207.8 63 98.9
70. Phenthoate 273.7 125 121
71. Phoratesulphone 199 152.9 97
72. Phoratesulfoxide 152.9 125 97
73. Phorate 75 47 41
74. Phosalone 181.8 111 75
75. Pirimiphosmethyl 304.7 290.1 276
76. Procymidone 283 255 96
77. Profenofos 337 267 309[भाग II—खण्ड 3(ii)] भारत का रािपत्र : असाधारण 111
S. No. Name of Pesticide Parent Ion Quant Ion Qualifier Ion
(Q1) (Q2) (Q3)
78. Propaquizafop 299 255 91
79. Quinolphos 156.8 102 77
80. Quizalofopethyl 298.8 255.3 192.2
81. Tebufenpyrad 318.1 145.1 131.1
82. Transfluthrin 162.8 143 91
83. Triazophos 160.9 134 106
84. Trifluralin 263 159.9 148
31. Estimation of cadmium, copper, chromium, lead and zinc -
As mentioned in the Schedule –IV, Part-D at serial number 10.
32. Estimation of arsenic -
As mentioned in the Schedule –IV, Part-D at serial number 12.
[F.No. 7-38/2024(Fert Law/BSC]
FRANKLIN L KHOBUNG, Jt. Secy.
Note: The principal Order was published in the Gazette of India vide G.S.R. number 758(E), dated the 25th
September, 1985 and was last amended vide S.O. 2346(E) dated 26th May, 2025.
Uploaded by Dte. of Printing at Government of India Press, Ring Road, Mayapuri, New Delhi-110064
and Published by the Controller of Publications, Delhi-110054.